Argyresthia spinosella

Stainton, 1849 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records3 451

Data sources7

Biological traits2

DNA specimens568

eDNA detections650

Sources7 archives

Databases and archives Argyresthia spinosella's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 451 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI650 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics568 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 451 records

Environmental DNA3 datasets · 13 countries650 detections

DNA & barcodingBOLD568 specimens

01Narrative

Argyresthia spinosella is a moth of the family Yponomeutidae. It is found in EuropeFauna Europaea and Anatolia. Argyresthia spinosella Goes, the Netherlands The wingspan is 9–11 mm.The head is white. Forewings are fuscous, with purple reflections, base ochreous ; a thick white dorsal streak to tornus ; a darker fuscous median fascia, interrupted in disc, edged with whitish on costa ; some whitish costal strigulae posteriorly. Hindwings are grey.Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description The moth flies from May to July. . The larvae feed on Prunus spinosa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding568 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia spinosella has left across the world's sequence archives.

At a glance

DNA specimens568

BINs1

Marker genes1

eDNA detections650

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus560 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

34Gmostly conserved

130Cmostly conserved

160Tvariable

172Amostly conserved

181Gmostly conserved

232Tmostly conserved

262Amostly conserved

361Cvariable

430Avariable

454Cmostly conserved

473Gvariable

539Tmostly conserved

559Amostly conserved

622Avariable

625Amostly conserved

ATTATATTTTATTTTTGGAATTTGATCTGGTATGGTAGGAACATCATTAAGATTATTAATTCGAGCAGAATTAGGTAACCCAGGATCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.83%

Haplotypes16

BIN1

Most divergent pair1.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia oreasellasame genus3.5%Argyresthia curvellasame genus4.7%Argyresthia bonnetellasame genus5.0%Argyresthia pulchellasame genus5.2%Argyresthia pruniellasame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 451 records

Wild obs. + sensor3 154

Museum / vouchered212

Other85

Origin

Native13

Range

Area of Occupancy AOO6 988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 1 002≤1 km 495≤10 km 1 262>10 km 43

2 802 georeferenced · 352 without coordinates

Open the mapobservation + sensor3 154

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 53≤1 km 44≤10 km 12

109 georeferenced · 103 without coordinates

Open the institutions mapphysical evidence212

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	40
DanishLepidopterologicalSocietylocation not on record	31
NHMOlocation not on record	25
Tartu, EE	12
Provincia di Livornolocation not on record	12
Tilburg, NL	12
Nijmegen, NL	11
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	8
Salzburg, AT	7
SLU Artdatabankenlocation not on record	6
ZSMlocation not on record	5
Oulu, FI	4
Uniwersytet Łódzkilocation not on record	3
South Kensington, GB	3
Tallinn, EE	1
Stockholm, SE	1
BioFokuslocation not on record	1
Natural History Museum, Londonlocation not on record	1
Research Collection of Peter Lichtmanneckerlocation not on record	1
Research Collection of Theo Gruenewaldlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Research Collection of Kai Berggrenlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

23 institutions · 188 of 212 vouchered records shown · 24 without an institution code

09Environmental DNA650 detections

Where the DNA of Argyresthia spinosella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found650

Studies independent surveys3

Countries13

Verifiable raw sequence linked85

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 650 detections have coordinates

Open the map13 countries0

edge forestforest pathflooded meadow, salix treesUrbanprivate gardenForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 13.2–19.7

Seasonal swing summer↔winter21.5 °C

Max temp (day)20.4 °C 15.4–23.9

Min temp (night)9.70 °C 7.90–13.4

Precipitation70.2 mm/mo 45.7–108

Air humidity56.9 % 56.4–60.6

Moisture balance-46.9 mm/mo -86.1–-22.1

Vapour deficit791 Pa 591–996

Wind speed1.90 m/s 1.60–3.50

Cloud cover38.5 % 35.3–41.3

CHELSA 1981–2010, ~9 km grid, at location & month of 650 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argyresthia spinosella

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type3 451 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 451 records