Argyresthia brockeella

(Hübner, 1805) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records8 896

Data sources7

Biological traits2

DNA specimens46

eDNA detections95

Sources7 archives

Databases and archives Argyresthia brockeella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 896 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI95 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics46 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF8 896 records

Environmental DNA4 datasets · 9 countries95 detections

DNA & barcodingBOLD46 specimens

01Narrative

Argyresthia brockeella is a moth of the family Yponomeutidae. It is found in Europe,Fauna Europaea east Siberia and Japan. The wingspan is 9–12 mm.The head and thorax are white. Forewings are deep coppery-golden; a spot on base of dorsum, a fascia at 1/3, three posterior semioval costal spots and a larger tornal spot shining white ; sometimes the fascia is connected with adjacent costal and dorsal spots. Hindwings are grey.The larva is pinkish-brown ; head brown ; plate of 2 partly blackish-edged.Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description The moth flies from May to September. . The larvae feed on the catkins of birch (Betula spp) and alder (Alnus glutinosa).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding46 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia brockeella has left across the world's sequence archives.

At a glance

DNA specimens46

BINs1

Marker genes1

eDNA detections95

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus37 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.15%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 3 variable positions, in barcode order

100Tmostly conserved

133Cmostly conserved

385Cmostly conserved

CACATTATATTTTATTTTTGGAATTTGATCTGGTATACTAGGAACATCTTTAAGATTACTAATTCGAGCAGAATTAGGTAACCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia calliphanessame genus7.6%Argyresthia goedartellasame genus8.2%Argyresthia retinellasame genus9.9%Argyresthia pulchellasame genus10.0%Argyresthia oreasellasame genus10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type8 896 records

Wild obs. + sensor7 806

Museum / vouchered1 028

Other62

Origin

Native7

Range

Area of Occupancy AOO13 808 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 2 614≤1 km 1 234≤10 km 3 359>10 km 12

7 219 georeferenced · 587 without coordinates

Open the mapobservation + sensor7 806

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 391≤1 km 210≤10 km 72>10 km 51

724 georeferenced · 304 without coordinates

Open the institutions mapphysical evidence1 028

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	259
Oulu, FI	117
NHMOlocation not on record	74
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	67
National Institute of Biological Resourceslocation not on record	38
Provincia di Livornolocation not on record	37
SLU Artdatabankenlocation not on record	35
Tartu, EE	31
Nijmegen, NL	24
Salzburg, AT	22
DABUHlocation not on record	14
Kuopio, FI	13
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	13
Philadelphia, US	11
Kushiro City Museumlocation not on record	10
Stockholm, SE	10
South Kensington, GB	9
Durban Natural Science Museumlocation not on record	7
Natural History Museum, Londonlocation not on record	5
Tallinn, EE	5
Rovaniemi, FI	5
ZSMlocation not on record	4
Tilburg, NL	3
European Distributed Institute of Taxonomy (EDIT)location not on record	3
neflocation not on record	3
Naturalis Biodiversity Centerlocation not on record	2
NKLTTlocation not on record	2
Iwate Prefectural Museumlocation not on record	2
University of Kaiserslauternlocation not on record	1
KIRMlocation not on record	1
CBDClocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
New Haven, US	1
BioFokuslocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1

36 institutions · 833 of 1 028 vouchered records shown · 195 without an institution code

09Environmental DNA95 detections

Where the DNA of Argyresthia brockeella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found95

Studies independent surveys4

Countries9

Verifiable raw sequence linked59

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 95 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 8.20–16.7

Seasonal swing summer↔winter19.3 °C

Max temp (day)18.0 °C 12.0–20.0

Min temp (night)10.6 °C 3.40–13.5

Precipitation76.2 mm/mo 53.7–105

Air humidity60.5 % 57.0–63.6

Moisture balance-32.1 mm/mo -61.1–21.6

Vapour deficit669 Pa 413–759

Wind speed2.80 m/s 2.30–4.20

Cloud cover48.3 % 38.1–55.3

CHELSA 1981–2010, ~9 km grid, at location & month of 94 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argyresthia brockeella

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type8 896 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 896 records