Argyresthia retinella

Zeller, 1839 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records9 701

Data sources7

Biological traits2

DNA specimens64

eDNA detections2 239

Sources7 archives

Databases and archives Argyresthia retinella's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 701 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 239 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics64 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF9 701 records

Environmental DNA4 datasets · 10 countries2 239 detections

DNA & barcodingBOLD64 specimens

01Narrative

Argyresthia retinella is a species of moth of the family Yponomeutidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)does not feed

Feeding guild (larval)herbivore

05DNA & barcoding64 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia retinella has left across the world's sequence archives.

At a glance

DNA specimens64

BINs1

Marker genes1

eDNA detections2 239

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus47 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

40Amostly conserved

82Tmostly conserved

103Tmostly conserved

169Avariable

208Gmostly conserved

217Avariable

247Tvariable

271Gvariable

403Gvariable

412Amostly conserved

463Cvariable

550Amostly conserved

557Tvariable

577Avariable

628Gmostly conserved

646Cvariable

AACATTATATTTTATTTTTGGAATTTGATCTGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.98%

Haplotypes9

BIN1

Most divergent pair2.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia pulchellasame genus7.1%Argyresthia conjugellasame genus7.4%Argyresthia pygmaeellasame genus7.6%Argyresthia goedartellasame genus7.6%Argyresthia calliphanessame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type9 701 records

Wild obs. + sensor4 160

Museum / vouchered5 478

Other63

Origin

Native4

Range

Area of Occupancy AOO10 416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 1 311≤1 km 1 065≤10 km 1 524>10 km 6

3 906 georeferenced · 254 without coordinates

Open the mapobservation + sensor4 160

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 4 893≤1 km 242≤10 km 90>10 km 65

5 290 georeferenced · 188 without coordinates

Open the institutions mapphysical evidence5 478

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oulu, FI	125
NHMOlocation not on record	109
DanishLepidopterologicalSocietylocation not on record	108
SLU Artdatabankenlocation not on record	55
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	54
Provincia di Livornolocation not on record	49
Tartu, EE	42
Kuopio, FI	34
Stockholm, SE	32
RMZlocation not on record	26
Tromsø, NO	19
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	15
Nijmegen, NL	9
DABUHlocation not on record	9
South Kensington, GB	8
Salzburg, AT	8
Natural History Museum Rotterdamlocation not on record	7
Rovaniemi, FI	6
Tilburg, NL	6
Philadelphia, US	5
ZMAAlocation not on record	5
ZSMlocation not on record	4
NTNU-VMlocation not on record	3
Natural History Museum, Londonlocation not on record	3
Bavarian State Collection of Zoologylocation not on record	3
neflocation not on record	3
Metsähallituslocation not on record	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
CBDClocation not on record	1
Research Collection of Theo Gruenewaldlocation not on record	1
Brussels, BE	1
MZLUlocation not on record	1
University of Oslo, Natural History Museumlocation not on record	1
Kushiro City Museumlocation not on record	1

34 institutions · 755 of 5 478 vouchered records shown · 4 723 without an institution code

09Environmental DNA2 239 detections

Where the DNA of Argyresthia retinella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2 239

Studies independent surveys4

Countries10

Verifiable raw sequence linked2 176

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 239 detections have coordinates

Open the map10 countries0

Garden lawnAlpine willow zoneBog edge in alpine birch forestForest edge (suburban)Hay meadow

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 12.9–16.6

Seasonal swing summer↔winter21.1 °C

Max temp (day)18.9 °C 15.2–20.2

Min temp (night)11.1 °C 8.50–12.9

Precipitation88.9 mm/mo 60.4–105

Air humidity59.2 % 57.9–61.9

Moisture balance-21.3 mm/mo -58.4–28.0

Vapour deficit693 Pa 563–770

Wind speed2.70 m/s 2.00–3.90

Cloud cover49.5 % 40.1–56.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 239 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argyresthia retinella

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type9 701 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 701 records