Argyresthia cupressella

Walsingham, 1890 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records943

Data sources9

Biological traits2

DNA specimens27

eDNA detections25

Sources9 archives

Databases and archives Argyresthia cupressella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility943 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF943 records

Environmental DNA1 datasets · 3 countries25 detections

DNA & barcodingBOLD27 specimens

Genome at a glanceGoaT · NCBI≈768 Mbp

01Narrative

Argyresthia cupressella, the cypress tip moth, is a moth of the family Yponomeutidae. It is endemic to the western coast of the United States and Canada, but has been introduced in Europe.Fauna Europaea The wingspan is 8–9 mm. Adults are on wing from June to July depending on the location. The larvae feed on Chamaecyparis, Cupressocyparis, Thuja, Sequoia and Juniperus species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)does not feed

Feeding guild (larval)herbivore

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia cupressella has left across the world's sequence archives.

At a glance

DNA specimens27

BINs2

Marker genes1

eDNA detections25

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 59 variable positions, in barcode order

31Tmostly conserved

40Tmostly conserved

43Amostly conserved

49Amostly conserved

64Cmostly conserved

82Cmostly conserved

85Amostly conserved

91Tmostly conserved

133Tmostly conserved

160Gmostly conserved

163Amostly conserved

193Cmostly conserved

200Gmostly conserved

202Amostly conserved

214Avariable

220Amostly conserved

226Tmostly conserved

235Cmostly conserved

238Tmostly conserved

250Cmostly conserved

259Cmostly conserved

266Cmostly conserved

268Tmostly conserved

271Cmostly conserved

301Tmostly conserved

313Amostly conserved

358Tmostly conserved

364Cmostly conserved

370Tmostly conserved

373Tmostly conserved

391Cmostly conserved

397Cmostly conserved

412Amostly conserved

415Amostly conserved

457Tmostly conserved

472Tmostly conserved

479Amostly conserved

497Tmostly conserved

505Cmostly conserved

508Amostly conserved

517Tmostly conserved

519Gmostly conserved

529Amostly conserved

530Gmostly conserved

536Tmostly conserved

538Amostly conserved

544Cmostly conserved

547Amostly conserved

553Cmostly conserved

595Tmostly conserved

596Tmostly conserved

607Tmostly conserved

613Cmostly conserved

619Tmostly conserved

620Gmostly conserved

622Tmostly conserved

625Amostly conserved

634Tmostly conserved

637Tvariable

AACATTATATTTTATTTTTGGAATTTGATCTGGAATAGTTGGAACATCATTAAGATTATTAATCCGAGCTGAATTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.5%

Haplotypes5

BINs2

Most divergent pair8.8%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia aurulentellasame genus5.6%Argyresthia columbiasame genus6.8%Argyresthia arceuthinasame genus6.8%Argyresthia pseudotsugasame genus7.3%Argyresthia quadristrigellasame genus7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Argyresthia cupressella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈768 396 222 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Argyresthia cupressella0.77 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.6% BUSCO

08Occurrence & distribution

Record type943 records

Wild obs. + sensor910

Museum / vouchered33

Range

Area of Occupancy AOO844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 433≤1 km 8≤10 km 404>10 km 5

850 georeferenced · 60 without coordinates

Open the mapobservation + sensor910

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 2≤1 km 5≤10 km 2

9 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	16
South Kensington, GB	9
Canadian Forest Service, Pacific Forestry Centrelocation not on record	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
Natural History Museum, Londonlocation not on record	2
Catholic University of Pekinglocation not on record	1
Essig Museum of Entomologylocation not on record	1

7 institutions · 33 of 33 vouchered records shown

09Environmental DNA25 detections

Where the DNA of Argyresthia cupressella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 13.2–18.5

Seasonal swing summer↔winter13.1 °C

Max temp (day)18.4 °C 16.8–24.2

Min temp (night)11.2 °C 9.50–14.2

Precipitation54.3 mm/mo 46.2–116

Air humidity61.5 % 56.4–62.4

Moisture balance-67.5 mm/mo -72.5–2.90

Vapour deficit638 Pa 579–956

Wind speed3.10 m/s 1.60–4.80

Cloud cover42.3 % 34.4–45.8

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)