Argyresthia abdominalis

Zeller, 1839 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records2 803

Data sources7

Biological traits2

DNA specimens53

eDNA detections204

Sources7 archives

Databases and archives Argyresthia abdominalis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 803 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI204 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics53 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 803 records

Environmental DNA3 datasets · 9 countries204 detections

DNA & barcodingBOLD53 specimens

01Narrative

Argyresthia abdominalis is a moth of the family Yponomeutidae. It is found in most of Europe, except Ireland, the Iberian Peninsula, Slovenia, Greece, Ukraine and Lithuania.Fauna Europaea The wingspan is 7–9 mm.microlepidoptera.nl The larvae feed on Juniperus communis. A single larva mines out several leaves, feeding from the base to the tip. It migrates to the next leaf using a short corridor in the bark of the twig. Pupation takes place outside of the mine in a spinning on the twig. The larvae have an orange brown to spotted reddish brown body and a black head. They can be found from March to April.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)does not feed

Feeding guild (larval)herbivore

05DNA & barcoding53 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia abdominalis has left across the world's sequence archives.

At a glance

DNA specimens53

BINs1

Marker genes1

eDNA detections204

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus47 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

463Cvariable

499Cmostly conserved

620Gmostly conserved

AACATTATATTTTATTTTTGGAATCTGATCAGGTATAGTAGGAACATCTATAAGATTATTAATTCGAGCTGAATTAGGTAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.19%

Haplotypes4

BIN1

Most divergent pair0.61%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia aurulentellasame genus6.2%Argyresthia arceuthinasame genus6.8%Argyresthia trifasciatasame genus6.8%Argyresthia amiantellasame genus7.8%Argyresthia quadristrigellasame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 803 records

Wild obs. + sensor2 138

Museum / vouchered651

Other14

Range

Area of Occupancy AOO4 204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 1 020≤1 km 397≤10 km 617>10 km 1

2 035 georeferenced · 103 without coordinates

Open the mapobservation + sensor2 138

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 367≤1 km 135≤10 km 48>10 km 26

576 georeferenced · 75 without coordinates

Open the institutions mapphysical evidence651

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oulu, FI	90
NHMOlocation not on record	65
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	33
SLU Artdatabankenlocation not on record	27
Tartu, EE	26
Kuopio, FI	24
Rovaniemi, FI	15
Provincia di Livornolocation not on record	13
Stockholm, SE	8
South Kensington, GB	6
Tilburg, NL	6
DanishLepidopterologicalSocietylocation not on record	5
European Distributed Institute of Taxonomy (EDIT)location not on record	4
Natural History Museum, Londonlocation not on record	4
ZSMlocation not on record	3
NTNU-VMlocation not on record	3
Nijmegen, NL	2
Tromsø, NO	2
RMZlocation not on record	1
Tiroler Landesmuseum Ferdinandeumlocation not on record	1
Metsähallituslocation not on record	1
DABUHlocation not on record	1
neflocation not on record	1
Research Collection of Kai Berggrenlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

25 institutions · 343 of 651 vouchered records shown · 308 without an institution code

09Environmental DNA204 detections

Where the DNA of Argyresthia abdominalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found204

Studies independent surveys3

Countries9

Verifiable raw sequence linked155

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 204 detections have coordinates

Open the map9 countries0

Bog edge in alpine birch forestjuniperus forestFarmland, coast and birch habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 12.6–17.2

Seasonal swing summer↔winter19.7 °C

Max temp (day)19.5 °C 15.7–21.8

Min temp (night)11.4 °C 7.90–13.5

Precipitation89.2 mm/mo 57.3–144

Air humidity59.6 % 58.0–61.6

Moisture balance-21.3 mm/mo -55.5–51.9

Vapour deficit734 Pa 567–809

Wind speed2.50 m/s 2.20–3.70

Cloud cover43.8 % 37.7–62.2

CHELSA 1981–2010, ~9 km grid, at location & month of 203 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argyresthia abdominalis

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type2 803 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 803 records