Argiope radon

Levi, 1983 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Argiope

At a glance

Occurrence records266

Data sources8

Biological traits0

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Argiope radon's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility266 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF266 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

Argiope radon is a species of orb web spider native to Australia. It is found in tropical areas of the Northern Territory, Western Australia and Queensland. It is commonly known as the Northern St Andrew's cross spider. Like most orb-weaving spiders, males are much smaller than females. The female grows to around 18 mm in body length while the male is around 6 mm. Females of this species construct web decorations. There were 86 records of Argiope radon listed in Australia as of January 2021. They tend to either form aggregations with spiders of the same species or are found as solitary individuals, and their states heavily impact their web decorating abilities. Their webs are greatly affected by humidity, but are less affected by temperature changes.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argiope radon has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

163Amostly conserved

208Gmostly conserved

209Cvariable

214Tmostly conserved

232Tmostly conserved

235Tmostly conserved

265Tmostly conserved

268Cmostly conserved

286Amostly conserved

292Tmostly conserved

313Tmostly conserved

322Amostly conserved

394Cvariable

484Amostly conserved

520Tmostly conserved

526Tmostly conserved

529Tmostly conserved

571Cmostly conserved

589Avariable

616Tvariable

628Ahighly variable

631Tvariable

646Avariable

TTTATATTTAATTTTTGGAGCTTGGGCTGCTATAGTAGGAACAGCCATAAGAGTATTAATTCGAATTGAATTGGGTCAGCCTGGAAGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes3

BIN1

Most divergent pair2.9%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argiope appensasame genus7.4%Argiope modestasame genus7.7%Argiope aethereasame genus8.0%Argiope minutasame genus8.3%Argiope pulchellasame genus8.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type266 records

Wild obs. + sensor238

Museum / vouchered28

Range

Area of Occupancy AOO596 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 69≤1 km 46≤10 km 17>10 km 18

150 georeferenced · 88 without coordinates

Open the mapobservation + sensor238

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 28 records without

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Western Australian Museumlocation not on record	9
Museum and Art Gallery of the Northern Territorylocation not on record	6
Sydney, AU	4
Natick, US	3
Museums Victorialocation not on record	3
QVMAGlocation not on record	2
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1

7 institutions · 28 of 28 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Argiope radon was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

Open forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 19.9–29.0

Seasonal swing summer↔winter8.60 °C

Max temp (day)29.3 °C 25.6–31.4

Min temp (night)19.9 °C 14.4–26.6

Precipitation33.4 mm/mo 18.3–95.0

Air humidity58.4 % 47.6–59.9

Moisture balance-106 mm/mo -162–-66.5

Vapour deficit1,537 Pa 1,059–1,732

Wind speed3.40 m/s 1.90–4.40

Cloud cover30.8 % 21.4–36.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)