Argiope aetherea

(Walckenaer, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Argiope

At a glance

Occurrence records1 594

Data sources9

Biological traits4

DNA specimens4

eDNA detections6

Sources9 archives

Databases and archives Argiope aetherea's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 594 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

World Spider Trait DBMasaryk University4 traits · 2 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Occurrence & distributionGBIF1 594 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD4 specimens

01Narrative

Argiope aetherea is a common, large orb-web spider (family Araneidae). Like other species of Argiope, it is commonly known as the St Andrew's Cross spider, due to the characteristic cross-shaped web decorations female spiders often include in their webs. A. aetherea is similar in appearance to A. keyserlingi, however female A. aetherea are generally larger than A. keyserlingi. Like most orb-web spiders, A. aetherea shows considerable sexual size dimorphism, with females being many times larger than males.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesCraig et al. 2020Pekár 2014a

Biomechanics3

Silk strain0.37 mm

Silk strength628 mm

Silk toughness198 mm

Defence1

Primary defenceCrypsis

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argiope aetherea has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P689 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.41%

Haplotypes1

BIN1

Where individuals differ — all 4 variable positions, in barcode order

222Avariable

267Cvariable

312Avariable

513Avariable

ACTTTATATTTAATTTTTGGAGCTTGGGCTGCTATAGTAGGTACAGCAATAAGAGTATTAATTCGAATTGAATTAGGTCAACCTGGAAGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argiope appensasame genus4.9%Argiope modestasame genus5.4%Argiope radonsame genus8.0%Argiope keyserlingisame genus8.4%Argiope minutasame genus8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 594 records

Wild obs. + sensor1 446

Museum / vouchered148

Range

Area of Occupancy AOO3 496 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 693≤1 km 212≤10 km 119>10 km 119

1 143 georeferenced · 303 without coordinates

Open the mapobservation + sensor1 446

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 3≤1 km 3≤10 km 15>10 km 3

24 georeferenced · 124 without coordinates

Open the institutions mapphysical evidence148

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	89
Museums Victorialocation not on record	23
Natick, US	12
Western Australian Museumlocation not on record	10
Frankfurt am Main	7
Cambridge, US	3
Museum and Art Gallery of the Northern Territorylocation not on record	3
Tasmanian Museum & Art Gallerylocation not on record	1

8 institutions · 148 of 148 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Argiope aetherea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

Urbanroadside

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 19.5–25.0

Seasonal swing summer↔winter8.20 °C

Max temp (day)26.9 °C 23.5–29.2

Min temp (night)18.4 °C 14.6–21.4

Precipitation27.3 mm/mo 20.5–70.4

Air humidity58.2 % 50.1–60.8

Moisture balance-71.5 mm/mo -141–-51.2

Vapour deficit1,179 Pa 950–1,461

Wind speed2.70 m/s 1.60–3.50

Cloud cover28.5 % 21.6–31.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argiope aetherea

At a glance

Sources9 archives

Biomechanics3

Defence1

At a glance

Record type1 594 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 594 records