Argiope appensa

(Walckenaer, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Argiope

At a glance

Occurrence records4 340

Data sources8

Biological traits0

DNA specimens17

eDNA detections18

Sources8 archives

Databases and archives Argiope appensa's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 340 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 340 records

Environmental DNA1 datasets · 2 countries18 detections

DNA & barcodingBOLD17 specimens

01Narrative

Argiope appensa, also referred to as the Hawaiian garden spiderArgiope apensa at BugGuide.net or banana spider, is an orb-weaving spider belonging to the family Araneidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argiope appensa has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections18

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.05%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

277Tmostly conserved

TACTTTATATTTAATTTTTGGAGCTTGGGCTGCTATAGTAGGGACAGCAATAAGAGTATTGATTCGAATTGAATTAGGTCAACCCGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argiope modestasame genus2.4%Argiope aethereasame genus4.9%Argiope radonsame genus7.4%Argiope minutasame genus8.4%Argiope pulchellasame genus8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 340 records

Wild obs. + sensor4 309

Museum / vouchered31

Range

Area of Occupancy AOO5 200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 2 554≤1 km 551≤10 km 267>10 km 272

3 644 georeferenced · 665 without coordinates

Open the mapobservation + sensor4 309

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 8≤1 km 1≤10 km 3>10 km 4

16 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	9
Mangilao, GU	8
Frankfurt am Main	2
Denver, US	1

4 institutions · 20 of 31 vouchered records shown · 11 without an institution code

09Environmental DNA18 detections

Where the DNA of Argiope appensa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.5 °C 22.2–25.2

Seasonal swing summer↔winter3.10 °C

Max temp (day)23.4 °C 23.4–26.2

Min temp (night)21.8 °C 20.9–24.2

Precipitation119 mm/mo 67.5–137

Air humidity61.0 % 58.7–67.1

Moisture balance-33.7 mm/mo -135–5.60

Vapour deficit1,058 Pa 921–1,281

Wind speed3.70 m/s 3.70–6.10

Cloud cover40.1 % 26.0–40.1

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argiope appensa

At a glance

Sources8 archives

At a glance

Record type4 340 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 340 records