Argiope pulchella

Thorell, 1881 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Argiope

At a glance

Occurrence records935

Data sources9

Biological traits1

DNA specimens27

eDNA detections1

Sources9 archives

Databases and archives Argiope pulchella's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility935 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

World Spider Trait DBMasaryk University1 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF935 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD27 specimens

01Narrative

Argiope pulchella is a species of the orb-weaver spider family, Araneidae. It ranges from India to China and can be found on Java. It is a synanthropic species, often living in habitats associated with humans.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár 2014a

Defence1

Primary defenceCrypsis

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argiope pulchella has left across the world's sequence archives.

At a glance

DNA specimens27

BINs3

Marker genes1

eDNA detections1

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 49 variable positions, in barcode order

4Gmostly conserved

10Tmostly conserved

58Gmostly conserved

73Amostly conserved

76Amostly conserved

100Gmostly conserved

103Tmostly conserved

110Cmostly conserved

121Gmostly conserved

124Tmostly conserved

127Amostly conserved

160Amostly conserved

175Amostly conserved

190Amostly conserved

193Tmostly conserved

196Amostly conserved

202Gmostly conserved

217Amostly conserved

220Cmostly conserved

263Tmostly conserved

319Amostly conserved

322Gmostly conserved

334Tmostly conserved

337Amostly conserved

340Tmostly conserved

352Tmostly conserved

358Amostly conserved

370Tmostly conserved

373Amostly conserved

382Tmostly conserved

403Gvariable

433Avariable

478Amostly conserved

508Tmostly conserved

511Amostly conserved

517Tmostly conserved

544Tmostly conserved

547Gmostly conserved

553Gmostly conserved

565Gmostly conserved

577Amostly conserved

578Tmostly conserved

589Cmostly conserved

592Cvariable

595Tmostly conserved

625Gmostly conserved

631Amostly conserved

649Avariable

655Gmostly conserved

TACGTTATATTTAATTTTTGGTGCTTGGGCTGCCATAGTAGGGACAGCAATAAGAGTGTTAATTCGAATTGAATTAGGTCAACCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes9

BINs3

Most divergent pair2.0%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argiope keyserlingisame genus8.1%Argiope appensasame genus8.4%Argiope minutasame genus8.4%Argiope modestasame genus8.6%Argiope aethereasame genus8.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type935 records

Wild obs. + sensor883

Museum / vouchered51

Other1

Range

Area of Occupancy AOO2 672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 274≤1 km 224≤10 km 118>10 km 46

662 georeferenced · 221 without coordinates

Open the mapobservation + sensor883

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence51

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Frankfurt am Main	31
Copenhagen, DK	8
Cambridge, US	1

3 institutions · 40 of 51 vouchered records shown · 11 without an institution code

09Environmental DNA1 detections

Where the DNA of Argiope pulchella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)