Argiope minuta

Karsch, 1879 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Argiope

At a glance

Occurrence records819

Data sources7

Biological traits0

DNA specimens6

eDNA detections10

Sources7 archives

Databases and archives Argiope minuta's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility819 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF819 records

Environmental DNA1 datasets · 3 countries10 detections

DNA & barcodingBOLD6 specimens

01Narrative

Argiope minuta is a species of spider in the family Araneidae. It is found in India, Bangladesh, China, Taiwan, Korea and Japan.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argiope minuta has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes2

eDNA detections10

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.71%

Haplotypes2

BIN1

Most divergent pair1.1%

Where individuals differ — all 7 variable positions, in barcode order

166Avariable

197Cvariable

343Avariable

436Gvariable

548Cvariable

586Cvariable

649Avariable

TACTTTATATTTAATTTTTGGGGCTTGGGCTGCTATAGTAGGAACAGCAATAAGAGTATTAATTCGAATTGAATTGGGTCAACCTGGGAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argiope keyserlingisame genus7.5%Argiope radonsame genus8.3%Argiope appensasame genus8.4%Argiope pulchellasame genus8.4%Argiope aethereasame genus8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type819 records

Wild obs. + sensor710

Museum / vouchered109

Range

Area of Occupancy AOO2 184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 199≤1 km 109≤10 km 38>10 km 55

401 georeferenced · 309 without coordinates

Open the mapobservation + sensor710

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 109 records without

Open the institutions mapphysical evidence109

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
KIBSlocation not on record	43
NSMKlocation not on record	17
Kawasaki Shi Tama Ku, JP	17
National Institute of Biological Resourceslocation not on record	15
KBISlocation not on record	4
YPIMlocation not on record	3
Bando, JP	1
Tomioka, JP	1
Frankfurt am Main	1
National Biodiversity Centre, Bhutanlocation not on record	1

10 institutions · 103 of 109 vouchered records shown · 6 without an institution code

09Environmental DNA10 detections

Where the DNA of Argiope minuta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.6 °C 20.3–23.9

Seasonal swing summer↔winter23.1 °C

Max temp (day)27.2 °C 23.5–28.1

Min temp (night)16.0 °C 15.2–19.9

Precipitation194 mm/mo 39.0–315

Air humidity64.5 % 49.5–66.5

Moisture balance36.1 mm/mo -132–199

Vapour deficit1,080 Pa 827–1,380

Wind speed3.40 m/s 1.90–4.70

Cloud cover41.0 % 27.8–48.4

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)