Araniella alpica

(L.Koch, 1869) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Araniella

At a glance

Occurrence records693

Data sources7

Biological traits14

DNA specimens9

eDNA detections0

Sources7 archives

Databases and archives Araniella alpica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility693 records↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

World Spider Trait DBMasaryk University14 traits · 21 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements21 literature sources14 traits

Occurrence & distributionGBIF693 records

DNA & barcodingBOLD9 specimens

01Narrative

De dennenkomkommerspin is een vrij algemene spinnensoort uit de familie wielwebspinnen. De soort komt niet voor in Nederland en België, maar wel in een groot deel van Europa. De habitat bestaat uit bergen en heuvels. Het vrouwtje wordt 5 tot 6 mm groot, het mannetje 4 tot 5 mm. De spin heeft zes punten op het achterlijf.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 21 sources

Pekár 2014aMacías-Hernández et al. 2020Buchar & Růžička 2002Henriksen & Hilmo 2015Gajdoš et al. 2014SLU 2020Staręga et al. 2001Bruun & Lissner 2019Hyvärinen et al. 2019Harvey et al. 2017Řezáč et al. 2015Blick & Scheidler 2004Finch 2004Martin 2012Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Liste France 2018Blick et al. 2016Nentwig et al. 2018Cardoso et al. 2011

Morphometry6

Body length♀6.43·♂4.57 mm

Cephalothorax height♀0.571·♂0.428 mm

Cephalothorax length♀2.36·♂1.96 mm

Cephalothorax width♀2.14·♂1.43 mm

Fang length♀0.5·♂0.341 mm

Tibia I length♀1.86·♂1.61 mm

Predation1

Hunting guildorb web weavers

Ecology6

Circadian activity0.8 mm

Light 2partly shaded

Moisture 2semi-humid

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryLeast Concern (LC)

Stratum0.53 mm

Defence1

Retreatleaf

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araniella alpica has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P561 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

42Amostly conserved

288Tvariable

504Tvariable

546Amostly conserved

GCCATGAGAGTATTAATTCGGGTAGAATTGGGTCAGTCAGGAAGGTTTCTTGGGGATGACCAGTTATATAATGTAATTGTCACAGCACAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.26%

Haplotypes4

BIN1

Most divergent pair0.71%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Araniella opisthographasame genus11.8%Araniella cucurbitinasame genus11.9%Argiope blandasame family13.5%Argiope catenulatasame family13.5%Araniella proximasame genus13.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type693 records

Wild obs. + sensor587

Museum / vouchered98

Cultivated / captive1

Other7

Origin

Native31

Range

Area of Occupancy AOO2 100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 194≤1 km 124≤10 km 143>10 km 3

464 georeferenced · 123 without coordinates

Open the mapobservation + sensor587

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 10≤1 km 7≤10 km 41>10 km 3

61 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence98

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussels, BE	16
SLU Artdatabankenlocation not on record	11
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	7
Copenhagen, DK	6
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	4
European Distributed Institute of Taxonomy (EDIT)location not on record	3
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	3
MZLUlocation not on record	3
Akademia Pomorska w Słupskulocation not on record	2
Uniwersytet w Białymstokulocation not on record	2
Frankfurt am Main	2
NTNU-VMlocation not on record	1
Helsinki, FI	1
Bonn, DE	1

14 institutions · 62 of 98 vouchered records shown · 36 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)