Araniella proxima

(Kulczyński, 1885) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Araniella

At a glance

Occurrence records346

Data sources8

Biological traits4

DNA specimens17

eDNA detections25

Sources8 archives

Databases and archives Araniella proxima's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility346 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

World Spider Trait DBMasaryk University4 traits · 12 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements12 literature sources4 traits

Occurrence & distributionGBIF346 records

Environmental DNA3 datasets · 5 countries25 detections

DNA & barcodingBOLD17 specimens

01Narrative

Araniella proxima is a species of orb weaver in the spider family Araneidae. It is found in North America, Europe, a range from Russia (Europe to Far East), Turkey, Iran, and Kazakhstan.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 12 sources

Hyvärinen et al. 2019Liste France 2018Henriksen & Hilmo 2015Gajdoš et al. 2014SLU 2020Gajdoš & Svatoň 2001Blick et al. 2016Nährig et al. 2003Kielhorn 2017Martin 2012Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀7·♂5 mm

Predation1

Hunting guildorb web weavers

Ecology2

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryEndangered (2)

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araniella proxima has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections25

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.18%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 5 variable positions, in barcode order

343Amostly conserved

529Tmostly conserved

628Tmostly conserved

629Gmostly conserved

649Gmostly conserved

TACTTTATATTTGATTTTTGGGGCTTGGGCAGCCATAGTTGGGACTGCAATAAGTGTGTTGATTCGAGTTGAATTAGGGCAATCTGGGAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Araniella cucurbitinasame genus6.3%Araniella opisthographasame genus8.9%Araniella displicatasame genus11.9%Cyclosa insulanasame family13.2%Hortophora biapicatasame family13.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type346 records

Wild obs. + sensor121

Museum / vouchered224

Other1

Origin

Native1

Range

Area of Occupancy AOO1 084 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 63≤1 km 41≤10 km 7>10 km 2

113 georeferenced · 8 without coordinates

Open the mapobservation + sensor121

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 21≤1 km 25≤10 km 99>10 km 20

165 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence224

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	97
Ekaterinburg, RU	26
Edmonton, CA	15
Tartu, EE	14
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	12
Cambridge, US	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Brussels, BE	5
Institute of Plant and Animal Ecology (IPAE) UB RASlocation not on record	3
Adam Mickiewicz University in Poznańlocation not on record	2
Rovaniemi, FI	1
SLU Artdatabankenlocation not on record	1
University of Alaska Museumlocation not on record	1
Bonn, DE	1
Royal Saskatchewan Museumlocation not on record	1

15 institutions · 190 of 224 vouchered records shown · 34 without an institution code

09Environmental DNA25 detections

Where the DNA of Araniella proxima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys3

Countries5

Verifiable raw sequence linked8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map5 countries0

Forest1. Forest & WoodlandMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 8.00–14.5

Seasonal swing summer↔winter25.9 °C

Max temp (day)16.0 °C 11.2–18.3

Min temp (night)8.70 °C 4.50–11.4

Precipitation95.4 mm/mo 68.3–122

Air humidity60.6 % 57.2–63.1

Moisture balance9.70 mm/mo -39.9–60.7

Vapour deficit543 Pa 395–681

Wind speed2.50 m/s 1.80–3.90

Cloud cover53.7 % 46.4–57.7

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)