Araniella opisthographa

(Kulczyński, 1905) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Araniella

At a glance

Occurrence records2 806

Data sources9

Biological traits17

DNA specimens72

eDNA detections414

Sources9 archives

Databases and archives Araniella opisthographa's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 806 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI414 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics72 specimens↗

World Spider Trait DBMasaryk University17 traits · 26 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements26 literature sources17 traits

Occurrence & distributionGBIF2 806 records

Environmental DNA3 datasets · 13 countries414 detections

DNA & barcodingBOLD72 specimens

01Narrative

Araniella opisthographa is a species of orb weaver in the spider family Araneidae.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 26 sources

Simonneau et al. 2016Macías-Hernández et al. 2020Entling et al. 2007Buchar & Růžička 2002Harvey et al. 2017Gajdoš et al. 2014Staręga et al. 2001SLU 2020Henriksen & Hilmo 2015Bruun & Lissner 2019Hyvärinen et al. 2019Liste France 2018Maelfait et al. 1998Řezáč et al. 2015Blick & Scheidler 2004Kielhorn 2017Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Blick et al. 2016Nentwig et al. 2018Cardoso et al. 2011Pekár et al. 2012a

Morphometry6

Body length♀4.91·♂3.84 mm

Cephalothorax height♀0.556·♂0.556 mm

Cephalothorax length♀2.11·♂1.89 mm

Cephalothorax width♀1.96·♂1.78 mm

Fang length♀0.379·♂0.242 mm

Tibia I length♀1.67·♂1.48 mm

Predation2

Hunting guildorb web weavers

Prey diversity3.88 mm

Ecology9

Ballooningyes

Circadian activity0.74 mm

Light0.5 mm

Light 2partly shaded

Moisture 10.625 mm

Moisture 2dry

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categorySave or at low risk (SA)

Stratum0.7 mm

05DNA & barcoding72 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Araniella opisthographa has left across the world's sequence archives.

At a glance

DNA specimens72

BINs2

Marker genes1

eDNA detections414

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P561 bp consensus66 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 37 variable positions, in barcode order

9Tmostly conserved

27Gvariable

42Amostly conserved

51Tmostly conserved

60Tvariable

78Cmostly conserved

105Cmostly conserved

135Gmostly conserved

147Cmostly conserved

150Gmostly conserved

156Tmostly conserved

159Amostly conserved

171Gmostly conserved

174Cmostly conserved

177Cvariable

195Gmostly conserved

231Cmostly conserved

252Tvariable

264Gmostly conserved

273Amostly conserved

285Gmostly conserved

291Cmostly conserved

297Tmostly conserved

306Tmostly conserved

307Gmostly conserved

310Cmostly conserved

330Gmostly conserved

336Gmostly conserved

366Gmostly conserved

369Gmostly conserved

378Cmostly conserved

381Cmostly conserved

384Gmostly conserved

414Cmostly conserved

438Gmostly conserved

507Tmostly conserved

513Gmostly conserved

GCAATAAGTGTATTAATTCGAGTTGAGTTAGGGCAATCTGGAAGATTTCTTGGGGATGATCAATTGTATAATGTAATCGTTACAGCACAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes24

BINs2

Most divergent pair19.1%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Araniella cucurbitinasame genus8.4%Araniella proximasame genus8.9%Araniella displicatasame genus10.0%Araniella alpicasame genus11.8%Cyclosa insulanasame family12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 806 records

Wild obs. + sensor2 115

Museum / vouchered657

Other34

Origin

Native94

Range

Area of Occupancy AOO6 672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy47% within 1 km

≤100 m 623≤1 km 251≤10 km 978>10 km 15

1 867 georeferenced · 248 without coordinates

Open the mapobservation + sensor2 115

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 63≤1 km 21≤10 km 321>10 km 1

406 georeferenced · 251 without coordinates

Open the institutions mapphysical evidence657

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussels, BE	149
Bonn, DE	33
	32
SLU Artdatabankenlocation not on record	23
Adam Mickiewicz University in Poznańlocation not on record	21
Frankfurt am Main	18
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	14
Tartu, EE	13
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	9
RMZlocation not on record	8
Ekaterinburg, RU	6
Tilburg, NL	6
University of Lodz, Department of Invertebrate Zoology and Hydrobiologylocation not on record	4
European Distributed Institute of Taxonomy (EDIT)location not on record	4
SNSDlocation not on record	3
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	3
Akademia Pomorska w Słupskulocation not on record	3
SGAV-and-NHMDlocation not on record	3
Zoologisches Museum Hamburglocation not on record	3
South Kensington, GB	3
Liverpool, GB	3
Natural History Museum, Londonlocation not on record	2
Uniwersytet w Białymstokulocation not on record	2
Prioksko-Terrasnyi Biosphere Reservelocation not on record	2
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	2
Bern, CH	2
SNSB-Zoologische Staatssammlung Münchenlocation not on record	2
ZSMlocation not on record	2
Helsinki, FI	2
Natural History Museum, Bernlocation not on record	2
Universite de Montpellierlocation not on record	1
NTNU-VMlocation not on record	1
MZLUlocation not on record	1
neflocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Copenhagen, DK	1

36 institutions · 385 of 657 vouchered records shown · 272 without an institution code

09Environmental DNA414 detections

Where the DNA of Araniella opisthographa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found414

Studies independent surveys3

Countries13

Verifiable raw sequence linked350

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 414 detections have coordinates

Open the map13 countries0

Waldrand an Wiese, auf Laubzweigen1. Forest & Woodland|1.4. Temperate Foresthouse and surroundingsHeide, auf EichenzweigenRivuline vegetationDry acidic grasslands

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 0.4–16.2

Seasonal swing summer↔winter18.4 °C

Max temp (day)15.0 °C 3.60–19.2

Min temp (night)6.80 °C -2.10–13.0

Precipitation57.6 mm/mo 37.0–78.7

Air humidity61.3 % 57.5–67.5

Moisture balance-14.9 mm/mo -58.4–43.1

Vapour deficit522 Pa 234–757

Wind speed3.30 m/s 2.60–5.00

Cloud cover48.0 % 39.1–60.2

CHELSA 1981–2010, ~9 km grid, at location & month of 414 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Araniella opisthographa

At a glance

Sources9 archives

Morphometry6

Predation2

Ecology9

At a glance

Record type2 806 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 806 records