Argiope catenulata

(Doleschall, 1859) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Argiope

At a glance

Occurrence records517

Data sources9

Biological traits30

DNA specimens10

eDNA detections2

Sources9 archives

Databases and archives Argiope catenulata's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility517 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

World Spider Trait DBMasaryk University30 traits · 2 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources30 traits

Occurrence & distributionGBIF517 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD10 specimens

01Narrative

Argiope catenulata, also known as the grass cross spider, is a species of orb-weaver spiders (family Araneidae) ranging from India to the Philippines and Papua New Guinea, and also found in Australia in 2019. Like other species of the same genus, it builds a web with a zig-zag stabilimentum.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár 2014aBarrion & Litsinger 1995

Morphometry28

Abdomen length♀7.5·♂3 mm

Body length♀12.1·♂5.4 mm

Cephalothorax length♀4.6·♂2.4 mm

Cephalothorax width♀4·♂2.2 mm

Femur I length♀6.6·♂2.9 mm

Femur II length♀6.7·♂3.1 mm

Femur III length♀4.7·♂1.8 mm

Femur IV length♀7.2·♂2.9 mm

Leg I length♀23.3·♂10.7 mm

Leg II length♀22.5·♂10.5 mm

Leg III length♀13.5·♂5.5 mm

Leg IV length♀21.6·♂8.9 mm

Metatarsus I length♀7.3·♂3.2 mm

Metatarsus II length♀6.8·♂3 mm

Metatarsus III length♀3.6·♂1.4 mm

Metatarsus IV length♀6.4·♂2.6 mm

Patella I length♀2.1·♂1.1 mm

Patella II length♀2.2·♂0.95 mm

Patella III length♀1.1·♂0.6 mm

Patella IV length♀2.2·♂0.8 mm

Tarsus I length♀1.8·♂1.15 mm

Tarsus II length♀1.5·♂1.05 mm

Tarsus III length♀1.3·♂0.7 mm

Tarsus IV length♀1.2·♂0.9 mm

Tibia I length♀5.5·♂2.35 mm

Tibia II length♀5.3·♂2.4 mm

Tibia III length♀2.8·♂1 mm

Tibia IV length♀4.6·♂1.7 mm

Ecology1

Circadian activitydiurnal

Defence1

Primary defenceCrypsis

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argiope catenulata has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes2

eDNA detections2

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P671 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.79%

Haplotypes1

BIN1

Where individuals differ — all 8 variable positions, in barcode order

279Avariable

300Avariable

306Avariable

327Gvariable

486Gvariable

498Cvariable

508Tvariable

555Gvariable

TTAATTTTTGGTGCTTGGGCTGCTATAGTTGGTACAGCCATGAGAGTATTAATTCGAATTGAATTAGGACAACCTGGGAGGTTTATAGGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argiope keyserlingisame genus8.8%Argiope blandasame genus9.3%Argiope minutasame genus9.4%Argiope pulchellasame genus9.4%Gea theridioidessame family9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type517 records

Wild obs. + sensor495

Museum / vouchered22

Range

Area of Occupancy AOO1 356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 146≤1 km 117≤10 km 67>10 km 36

366 georeferenced · 129 without coordinates

Open the mapobservation + sensor495

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum and Art Gallery of the Northern Territorylocation not on record	9
Frankfurt am Main	2
Cambridge, US	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1

4 institutions · 13 of 22 vouchered records shown · 9 without an institution code

09Environmental DNA2 detections

Where the DNA of Argiope catenulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)