Apristurus sinensis

Chu & Hu, 1981 · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Carcharhiniformes/Scyliorhinidae/Apristurus

At a glance

Occurrence records437

Data sources9

Biological traits5

DNA specimens31

eDNA detections27

Sources9 archives

Databases and archives Apristurus sinensis's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility239 records↗

OBISOcean Biodiversity Information System198 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS437 records

Environmental DNA1 datasets · 1 countries27 detections

DNA & barcodingBOLD31 specimens

01Narrative

The South China catshark (Apristurus sinensis) is a catshark of the family Scyliorhinidae, known only from the holotype, which was taken from the South China Sea at a depth of 537 m. Its length is 42 cm, but this measurement was taken from an immature specimen. The reproduction of the South China catshark is oviparous.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length42 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathydemersal

Uses & economy1

Commercial importanceof no interest

Other traits1

Vulnerability32

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apristurus sinensis has left across the world's sequence archives.

At a glance

DNA specimens31

BINs3

Marker genes1

eDNA detections27

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

43Avariable

70Amostly conserved

85Gmostly conserved

100Cmostly conserved

157Gmostly conserved

160Tmostly conserved

205Amostly conserved

247Tmostly conserved

271Cmostly conserved

301Amostly conserved

310Gvariable

325Amostly conserved

334Cmostly conserved

406Avariable

418Amostly conserved

526Cmostly conserved

529Cmostly conserved

532Tmostly conserved

565Amostly conserved

613Tmostly conserved

625Gmostly conserved

649Cmostly conserved

CCTTTACCTAATTTTTGGTGCATGAGCAGGAATAGTTGGAATAGCTTTAAGCTTATTAATTCGCGCTGAACTAGGTCAACCCGGGTCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes9

BINs3

Most divergent pair3.7%

OceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apristurus platyrhynchussame genus2.8%Apristurus melanoaspersame genus4.8%Apristurus nasutussame genus5.4%Apristurus brunneussame genus6.3%Apristurus exsanguissame genus9.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type437 records

Wild obs. + sensor297

Museum / vouchered140

Range

Area of Occupancy AOO572 km²

Depth

0–200 m sunlit0

200–1000 m twilight13

1–4 km midnight142

>4 km abyssal0

median 1 119 m · max 1 338 m · 155 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤1 km 295≤10 km 2

297 georeferenced

Open the mapobservation + sensor297

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 6≤1 km 40≤10 km 40

86 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence140

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	34
Paris, FR	29
Sydney, AU	15
Museums Victorialocation not on record	9
Western Australian Museumlocation not on record	1
CSIRO, Australian National Fish Collectionlocation not on record	1

6 institutions · 89 of 140 vouchered records shown

09Environmental DNA27 detections

Where the DNA of Apristurus sinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 11.6–22.7

Seasonal swing summer↔winter5.70 °C

Max temp (day)18.6 °C 12.5–23.3

Min temp (night)16.4 °C 10.6–22.0

Precipitation82.5 mm/mo 28.3–146

Air humidity59.1 % 57.9–61.6

Vapour deficit840 Pa 555–1,008

Cloud cover29.1 % 20.5–42.2

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)