Apristurus platyrhynchus

(Tanaka, 1909) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Carcharhiniformes/Scyliorhinidae/Apristurus

At a glance

Occurrence records526

Data sources9

Biological traits6

DNA specimens6

eDNA detections5

Sources9 archives

Databases and archives Apristurus platyrhynchus's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility269 records↗

OBISOcean Biodiversity Information System257 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS526 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD6 specimens

01Narrative

The spatulasnout catshark (Apristurus platyrhynchus), also known as the Borneo catshark or flatnose catshark, is a catshark of the family Scyliorhinidae, found in the western Pacific between 35°N and 1° N. Its length is up to 80 cm.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length80 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathypelagic

Uses & economy1

Commercial importanceof no interest

Other traits2

Depth min759 m

Vulnerability52

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apristurus platyrhynchus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

187Gvariable

634Cmostly conserved

CCTTTACCTAATTTTTGGTGCATGAGCAGGAATAGTTGGAATGGCTTTAAGCTTATTAATTCGTGCTGAACTAGGTCAACCCGGATCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes3

BIN1

Most divergent pair0.31%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apristurus sinensissame genus2.8%Apristurus melanoaspersame genus4.1%Apristurus nasutussame genus4.8%Apristurus brunneussame genus6.1%Apristurus exsanguissame genus9.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type526 records

Wild obs. + sensor300

Museum / vouchered219

Other7

Range

Area of Occupancy AOO728 km²

Depth

0–200 m sunlit0

200–1000 m twilight70

1–4 km midnight100

>4 km abyssal0

median 1 022.8 m · max 1 338 m · 170 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 1≤1 km 278≤10 km 3

282 georeferenced · 18 without coordinates

Open the mapobservation + sensor300

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 21≤1 km 48≤10 km 54>10 km 5

128 georeferenced · 91 without coordinates

Open the institutions mapphysical evidence219

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	40
Sydney, AU	23
Paris, FR	17
Kagoshima University Museumlocation not on record	7
Museums Victorialocation not on record	4
Washington, US	3
CASlocation not on record	2
Natick, US	2
Zoologisches Museum Hamburglocation not on record	1
FishBaselocation not on record	1
CSIRO, Australian National Fish Collectionlocation not on record	1
Chicago, US	1
Western Australian Museumlocation not on record	1

13 institutions · 103 of 219 vouchered records shown · 10 without an institution code

09Environmental DNA5 detections

Where the DNA of Apristurus platyrhynchus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C 17.5–19.0

Seasonal swing summer↔winter7.20 °C

Max temp (day)19.9 °C 18.6–19.9

Min temp (night)17.9 °C 16.4–17.9

Precipitation147 mm/mo 143–147

Air humidity57.9 % 57.8–57.9

Vapour deficit919 Pa 840–919

Cloud cover29.1 % 24.3–29.1

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)