Apristurus nasutus

de Buen, 1959 · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Carcharhiniformes/Scyliorhinidae/Apristurus

At a glance

Occurrence records896

Data sources10

Biological traits7

DNA specimens17

eDNA detections17

Sources10 archives

Databases and archives Apristurus nasutus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility885 records↗

OBISOcean Biodiversity Information System11 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS896 records

Environmental DNA1 datasets · 1 countries17 detections

DNA & barcodingBOLD17 specimens

01Narrative

The largenose catshark (Apristurus nasutus) is a catshark of the family Scyliorhinidae. The largenose catshark is found on the upper continental slopes in the eastern Pacific, from the Gulf of Panama to Ecuador and central Chile, between 9°N and 28°S. It can grow up to 70 cm. Its reproduction is oviparous. This nose shark is considered to be a harmless species. It is known to originate from the Gulf of Panama, Ecuador, and Central Chile. This organism has a reported length of between 50-70 cm. This organism lives mostly on the Eastern Pacific Ocean. Though the biology on this species is not much known, this organism tends to stay together with the same organisms/traveling as a pack. These species are harmless to humans and are known as “oviparous breeding species”. Parasites of the largenose catshark, studied off Chile, include Monogeneans, Cestodes, and Nematodes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length70 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebathydemersal

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max925 m

Depth min400 m

Vulnerability48

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apristurus nasutus has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections17

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

160Tmostly conserved

493Cmostly conserved

654Tmostly conserved

CCTCTACCTAATTTTTGGTGCATGAGCAGGAATGGTCGGAATGGCTTTAAGTTTATTAATTCGTGCTGAACTAGGCCAACCCGGGTCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.05%

Haplotypes3

BIN1

Most divergent pair0.46%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apristurus melanoaspersame genus2.0%Apristurus brunneussame genus4.4%Apristurus platyrhynchussame genus4.8%Apristurus sinensissame genus5.4%Apristurus exsanguissame genus9.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type896 records

Wild obs. + sensor883

Museum / vouchered13

Range

Area of Occupancy AOO3 076 km²

Depth

0–200 m sunlit2

200–1000 m twilight8

1–4 km midnight0

>4 km abyssal0

median 561.8 m · max 797.5 m · 10 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 881 without coordinates

Open the mapobservation + sensor883

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 13 records without

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ICM-CSIClocation not on record	5
FishBaselocation not on record	1
Copenhagen, DK	1

3 institutions · 7 of 13 vouchered records shown

09Environmental DNA17 detections

Where the DNA of Apristurus nasutus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 14.1–14.1

Seasonal swing summer↔winter12.4 °C

Max temp (day)20.5 °C

Min temp (night)8.70 °C

Precipitation145 mm/mo

Air humidity58.8 %

Moisture balance39.0 mm/mo

Vapour deficit702 Pa

Wind speed2.50 m/s

Cloud cover20.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)