Apristurus melanoasper

Iglésias, Nakaya & Stehmann, 2004 · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Carcharhiniformes/Scyliorhinidae/Apristurus

At a glance

Occurrence records610

Data sources9

Biological traits7

DNA specimens27

eDNA detections28

Sources9 archives

Databases and archives Apristurus melanoasper's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility339 records↗

OBISOcean Biodiversity Information System271 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS610 records

Environmental DNA1 datasets · 4 countries28 detections

DNA & barcodingBOLD27 specimens

01Narrative

The black roughscale catshark (Apristurus melanoasper) is a catshark of the family Scyliorhinidae. It is recorded from the north Atlantic, eastern South Atlantic, in the Indian Ocean and around Australia and New Zealand. The species can be found on continental shelf at depths between 510 and 1,520 m. It can grow up to 90 cm.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length76.1 cm

Body mass1 288 g

Habitat & environment2

Habitat saltwateryes

Habitat zonebathypelagic

Other traits3

Depth max1 520 m

Depth min512 m

Vulnerability50.44

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apristurus melanoasper has left across the world's sequence archives.

At a glance

DNA specimens27

BINs1

Marker genes1

eDNA detections28

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 37 variable positions, in barcode order

4Cmostly conserved

34Gmostly conserved

43Gmostly conserved

64Tmostly conserved

100Tmostly conserved

112Cmostly conserved

124Cmostly conserved

157Gvariable

163Gmostly conserved

166Avariable

181Tmostly conserved

262Cvariable

301Cmostly conserved

325Gmostly conserved

334Tmostly conserved

337Cmostly conserved

344Cvariable

346Avariable

355Cmostly conserved

358Gmostly conserved

373Cmostly conserved

404Cvariable

406Gmostly conserved

427Amostly conserved

493Cmostly conserved

529Tmostly conserved

532Cmostly conserved

541Avariable

550Cmostly conserved

589Cmostly conserved

601Cmostly conserved

613Tmostly conserved

622Cmostly conserved

628Avariable

634Amostly conserved

637Cmostly conserved

643Cmostly conserved

CCTCTACCTAATTTTTGGTGCATGAGCAGGAATGGTTGGAATGGCTTTAAGCTTATTAATTCGTGCTGAACTAGGTCAACCCGGGTCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes8

BIN1

Most divergent pair15.3%

OceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apristurus nasutussame genus2.0%Apristurus platyrhynchussame genus4.1%Apristurus sinensissame genus4.8%Apristurus brunneussame genus5.2%Apristurus exsanguissame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type610 records

Wild obs. + sensor234

Museum / vouchered331

Other45

Range

Area of Occupancy AOO764 km²

Depth

0–200 m sunlit0

200–1000 m twilight54

1–4 km midnight115

>4 km abyssal0

median 1 069.9 m · max 1 380 m · 169 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 48≤1 km 170≤10 km 2>10 km 3

223 georeferenced · 11 without coordinates

Open the mapobservation + sensor234

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 39≤1 km 110≤10 km 39>10 km 38

226 georeferenced · 105 without coordinates

Open the institutions mapphysical evidence331

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	106
Paris, FR	25
Cambridge, US	20
Sydney, AU	15
South Kensington, GB	8
Museums Victorialocation not on record	4
Museum of New Zealand Te Papa Tongarewalocation not on record	4
Zoologisches Museum Hamburglocation not on record	3
The Atlantic Reference Centre (ARC)location not on record	2
CSIRO, Australian National Fish Collectionlocation not on record	2
Wuzhou, CN	1
IEO-COMA-CSIClocation not on record	1
University of Kansas, Biodiversity Research Centerlocation not on record	1

13 institutions · 192 of 331 vouchered records shown · 14 without an institution code

09Environmental DNA28 detections

Where the DNA of Apristurus melanoasper was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 7.60–22.0

Seasonal swing summer↔winter7.10 °C

Max temp (day)13.9 °C 10.1–25.2

Min temp (night)11.9 °C 5.60–19.7

Precipitation94.3 mm/mo 7.40–130

Air humidity62.6 % 57.9–72.8

Vapour deficit585 Pa 357–957

Cloud cover38.9 % 20.8–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)