Apristurus brunneus

(Gilbert, 1892) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Carcharhiniformes/Scyliorhinidae/Apristurus

At a glance

Occurrence records2 763

Data sources10

Biological traits7

DNA specimens14

eDNA detections13

Sources10 archives

Databases and archives Apristurus brunneus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 710 records↗

OBISOcean Biodiversity Information System1 053 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS2 763 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD14 specimens

01Narrative

The brown catshark (Apristurus brunneus) is commonly found in the Pacific Ocean, ranging from the northern Pacific waters off the coast of British Columbia and south to the Baja California peninsula in Mexico. They may live as far south as Ecuador and Peru. Brown catsharks are deep-water sharks that live on the outer continental shelf and the upper slope. They have been known to live at depths ranging from 30 to 650 m and live on the bottom, usually in muddy or sandy areas. The brown catshark, when originally described, was called Catulus brunneus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length69 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max1 306 m

Depth min33 m

Vulnerability47.6

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apristurus brunneus has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

16Tmostly conserved

168Tmostly conserved

223Cmostly conserved

241Amostly conserved

400Tmostly conserved

628Amostly conserved

646Amostly conserved

CCTTTACCTAATTTTTGGTGCATGAGCAGGAATAGTTGGAATGGGCTTAAGTTTATTAATTCGTGCTGAACTCGGTCAACCTGGGTCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.21%

Haplotypes3

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apristurus nasutussame genus4.4%Apristurus melanoaspersame genus5.2%Apristurus platyrhynchussame genus6.1%Apristurus sinensissame genus6.3%Apristurus exsanguissame genus9.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 763 records

Wild obs. + sensor2 254

Museum / vouchered507

Other2

Origin

Native125

Range

Area of Occupancy AOO3 156 km²

Depth

0–200 m sunlit67

200–1000 m twilight668

1–4 km midnight6

>4 km abyssal0

median 425.6 m · max 1 448 m · 741 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 45≤1 km 1≤10 km 2>10 km 12

60 georeferenced · 2 194 without coordinates

Open the mapobservation + sensor2 254

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤100 m 4≤1 km 4≤10 km 39>10 km 19

66 georeferenced · 441 without coordinates

Open the institutions mapphysical evidence507

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Los Angeles, US	85
CASlocation not on record	52
University of California San Diegolocation not on record	46
UWFClocation not on record	39
Oregon State Universitylocation not on record	10
Washington, US	8
Vancouver, CA	6
Wuzhou, CN	4
FishBaselocation not on record	3
Universidad Católica del Nortelocation not on record	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Moore Laboratory of Zoology, Occidental Collegelocation not on record	2
Cambridge, US	1
Barcelona, ES	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
University of Washington, Fish Collectionlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Toronto, CA	1
Copenhagen, DK	1
Chicago, US	1
Ann Arbor, US	1

21 institutions · 269 of 507 vouchered records shown · 12 without an institution code

09Environmental DNA13 detections

Where the DNA of Apristurus brunneus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 9.30–11.9

Seasonal swing summer↔winter6.90 °C

Max temp (day)12.7 °C 12.5–13.3

Min temp (night)11.2 °C 5.20–11.2

Precipitation241 mm/mo 92.6–241

Air humidity64.7 % 59.6–64.7

Vapour deficit489 Pa 472–489

Cloud cover51.4 % 43.1–51.4

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apristurus brunneus

At a glance

Sources10 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Record type2 763 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 763 records