Apristurus macrorhynchus

(Tanaka, 1909) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Carcharhiniformes/Scyliorhinidae/Apristurus

At a glance

Occurrence records127

Data sources9

Biological traits4

DNA specimens4

eDNA detections5

Sources9 archives

Databases and archives Apristurus macrorhynchus's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility76 records↗

OBISOcean Biodiversity Information System51 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS127 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD4 specimens

01Narrative

The flathead catshark (Apristurus macrorhynchus) is a catshark of the family Scyliorhinidae in the order Carcharhiniformes, found in the deep waters of the northwest Pacific Ocean.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebathydemersal

Uses & economy1

Commercial importanceof no interest

Other traits1

Vulnerability46.4

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apristurus macrorhynchus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

119Avariable

CCTCTACCTAATTTTTGGTGCATGAGCAGGAATGGTTGGCATAGCTTTAAGTTTATTAATTCGTGCTGAACTGGGTCAGCCTGGGTCTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apristurus exsanguissame genus10.6%Apristurus nasutussame genus11.8%Apristurus sinensissame genus12.0%Apristurus platyrhynchussame genus12.1%Apristurus brunneussame genus12.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type127 records

Wild obs. + sensor59

Museum / vouchered34

Other34

Origin

Native1

Range

Area of Occupancy AOO152 km²

Depth

0–200 m sunlit4

200–1000 m twilight18

1–4 km midnight1

>4 km abyssal0

median 440 m · max 1 513 m · 23 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 14

15 georeferenced · 44 without coordinates

Open the mapobservation + sensor59

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SNSB-Zoologische Staatssammlung Münchenlocation not on record	5
FishBaselocation not on record	2
Washington, US	2
Paris, FR	1
Louisiana State University, Museum of Zoologylocation not on record	1
Chicago, US	1

6 institutions · 12 of 34 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Apristurus macrorhynchus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 24.1–28.1

Seasonal swing summer↔winter8.70 °C

Max temp (day)26.9 °C 25.2–28.6

Min temp (night)24.7 °C 23.1–26.3

Precipitation134 mm/mo 32.1–235

Air humidity66.5 % 65.5–67.4

Vapour deficit1,136 Pa 1,039–1,232

Cloud cover31.3 % 26.0–36.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)