Aplysia dactylomela

Rang, 1828 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Aplysiida/Aplysiidae/Aplysia

At a glance

Occurrence records2 438

Data sources13

Biological traits8

DNA specimens48

eDNA detections30

Sources13 archives

Databases and archives Aplysia dactylomela's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 140 records↗

OBISOcean Biodiversity Information System298 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~1.86 Gbp↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements1 literature sources8 traits

Chemical compositionLOTUS · NPASS130 compounds

Occurrence & distributionGBIF · OBIS2 438 records

Environmental DNA1 datasets · 8 countries30 detections

DNA & barcodingBOLD48 specimens

Genome at a glanceGoaT1.9 Gbp

01Narrative

Aplysia dactylomela, the spotted sea hare, is a species of large sea slug, a marine opisthobranch gastropod in the family Aplysiidae, the sea hares.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology2

Body length41 cm

Body mass1 400 g

Life cycle & reproduction1

Max. longevity12 months

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits3

Depth max20 m

Depth min0 m

Vulnerability30

03Chemical composition130 compounds

Compounds documented for Aplysia dactylomela across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Chamigrane sesquiterpenoids40

Bisabolane sesquiterpenoids23

Cinnamic acids and derivatives7

Oxasqualenoids6

Laurane sesquiterpenoids6

Documented compounds130 total

Tissue Source Quantified only

Compound	Amount	Source
(1E,3E,5S,6R,7E)-8-bromo-1,5,6-trichloro-2-(dichloromethyl)-6-methylocta-1,3,7-triene	present	LOTUS
(1E,3E,5S,6S,7E)-8-bromo-1,5,6-trichloro-2-(dichloromethyl)-6-methylocta-1,3,7-triene	present	LOTUS
(1R,2S,4S,5R)-1,4-dibromo-5-chloro-2-[(E)-2-chloroethenyl]-1,5-dimethylcyclohexane	present	LOTUS
(1R,3R,5E,6S,7R,9R)-5-(1-bromopropylidene)-9-[(Z,1S)-1-chloropent-2-en-4-ynyl]-4,8-dioxatricyclo[4.2.1.03,7]nonane	present	LOTUS
(1R,3R,5S,7Z,9S,10S,12R)-9-bromo-3-(3-bromopropa-1,2-dienyl)-12-chloro-5-methyl-4,13-dioxabicyclo[8.2.1]tridec-7-ene	present	LOTUS
(1R,3S,4S)-3-bromo-1-[(1R,3S)-3-bromo-1,2,2-trimethylcyclopentyl]-4-chloro-4-methylcyclohexan-1-ol	present	LOTUS
(1R,3S,4S)-3-bromo-1-[(1S,3S,5R)-3-bromo-5-hydroxy-1,2,2-trimethylcyclopentyl]-4-chloro-4-methylcyclohexan-1-ol	present	LOTUS
(1R,3S,4S,5S)-3-((E)-3-(3,4-Dihydroxyphenyl)Acryloyloxy)-1,4,5-Trihydroxycyclohexanecarboxylic Acid	present	NPASS
(1R,4S)-4-[(2R,4aS,6R,8aR)-2-[(2S,5R)-5-bromo-2,6,6-trimethyloxan-2-yl]-4a-methyl-3,4,6,7,8,8a-hexahydro-2H-pyrano[3,2-b]pyran-6-yl]-1-[(2R,5R)-5-(2-hydroxypropan-2-yl)-2-methyloxolan-2-yl]pentane-1,4-diol	present	LOTUS
(1S,2R,5R,6R,10R,13S,15S)-6,10-dimethyl-5-[(2R)-6-methylheptan-2-yl]-16,17-dioxapentacyclo[13.2.2.01,9.02,6.010,15]nonadeca-8,18-dien-13-ol	present	LOTUS

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplysia dactylomela has left across the world's sequence archives.

At a glance

DNA specimens48

BINs3

Marker genes11

eDNA detections30

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 50 variable positions, in barcode order

10Tmostly conserved

34Tmostly conserved

35Cmostly conserved

37Amostly conserved

52Amostly conserved

64Tvariable

70Tmostly conserved

76Gmostly conserved

85Cmostly conserved

94Cmostly conserved

118Cvariable

133Cmostly conserved

166Amostly conserved

172Tmostly conserved

178Tmostly conserved

190Gmostly conserved

206Cvariable

208Gmostly conserved

209Tmostly conserved

229Amostly conserved

250Cmostly conserved

259Cmostly conserved

262Amostly conserved

295Cmostly conserved

322Avariable

346Tmostly conserved

385Tvariable

397Tmostly conserved

400Cmostly conserved

401Tmostly conserved

406Cmostly conserved

428Tvariable

460Cmostly conserved

463Cvariable

487Cmostly conserved

493Amostly conserved

499Tvariable

500Cmostly conserved

517Cmostly conserved

538Tmostly conserved

557Tmostly conserved

577Gmostly conserved

580Cvariable

598Cmostly conserved

604Tmostly conserved

610Cmostly conserved

616Tmostly conserved

631Amostly conserved

646Tmostly conserved

649Amostly conserved

AACATTATATATAATTTTTGGGATGTGATGTGGTCTAGTAGGTACAGGTTTAAGTCTTTTAATTCGATTTGAATTGGGTACTGCCGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes6

BINs2

Most divergent pair6.4%

AsiaN.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aplysia argussame genus5.5%Aplysia californicasame genus8.1%Aplysia fasciatasame genus8.2%Aplysia brasilianasame genus8.5%Aplysia moriosame genus9.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_015088 ↗ · 13 protein · 21 tRNA · 2 rRNA

COX1ND6ND5ND1ND4LCYTBCOX2ATP8ATP6ND3ND4COX3ND2l-rRNAs-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Aplysia dactylomela carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 858 200 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aplysia dactylomela1.86 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type2 438 records

Wild obs. + sensor2 080

Museum / vouchered358

Origin

Native3

Range

Area of Occupancy AOO4 472 km²

Depth

0–200 m sunlit102

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 5 m · max 425.5 m · 103 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 966≤1 km 402≤10 km 124>10 km 90

1 582 georeferenced · 498 without coordinates

Open the mapobservation + sensor2 080

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 11≤1 km 72≤10 km 27>10 km 31

141 georeferenced · 217 without coordinates

Open the institutions mapphysical evidence358

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	33
Washington, US	31
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	21
Philadelphia, US	16
New Haven, US	9
Cambridge, US	6
Los Angeles, US	6
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	5
Israel Oceanographic & Limnological Research, Ltd. The National Institute of Oceanographylocation not on record	5
Santa Barbara Museum of Natural Historylocation not on record	5
Natural History Museum Rotterdamlocation not on record	3
Texas Cooperative Wildlife Collectionlocation not on record	3
National Marine Biodiversity Institute of Korealocation not on record	3
Delaware Museum of Nature and Sciencelocation not on record	3
ELMClocation not on record	3
Toronto, CA	3
UM-RSMASlocation not on record	2
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	2
Universidad El Bosque (El Bosque)location not on record	2
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	2
Mexico City, MX	2
Auckland, NZ	2
Royal Museum for Central Africalocation not on record	1
Museo Nacional de Ciencias Naturales (CSIC)location not on record	1
Denver, US	1
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	1
Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institutelocation not on record	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Toyama, JP	1
Masindi, UG	1
Universidad del Valle (UniValle)location not on record	1
Chicago, US	1

32 institutions · 177 of 358 vouchered records shown · 5 without an institution code

09Environmental DNA30 detections

Where the DNA of Aplysia dactylomela was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map8 countries0

Marine

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 14.5–25.0

Seasonal swing summer↔winter17.9 °C

Max temp (day)18.9 °C 18.5–28.4

Min temp (night)12.5 °C 9.20–22.8

Precipitation72.2 mm/mo 36.8–114

Air humidity58.5 % 56.6–63.2

Moisture balance-36.1 mm/mo -94.7–4.30

Vapour deficit782 Pa 758–1,235

Wind speed2.60 m/s 1.80–3.10

Cloud cover38.3 % 31.6–42.4

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aplysia dactylomela

At a glance

Sources13 archives

Size & morphology2

Life cycle & reproduction1

Habitat & environment2

Other traits3

Compound class profile5 classes

Documented compounds130 total

At a glance

Genome sizehow big the whole instruction manual is

Record type2 438 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 438 records