Aplysia fasciata
Poiret, 1789 · speciesAt a glance
Occurrence records1 641
Data sources9
Biological traits7
DNA specimens11
eDNA detections17
Sources9 archives
Databases and archives Aplysia fasciata's data was compiled from.
WikipediaWikimedia Foundation5 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility1 482 records↗
OBISOcean Biodiversity Information System159 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics11 specimens↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
Catalogue of LifeCOLtaxonomy↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements1 literature sources7 traits
Chemical compositionLOTUS · NPASS34 compounds
Occurrence & distributionGBIF · OBIS1 641 records
Environmental DNA1 datasets · 4 countries17 detections
DNA & barcodingBOLD11 specimens
01Narrative
Aplysia fasciata, common name the "mottled sea hare", or the "sooty sea hare", is an Atlantic species of sea hare or sea slug, a marine opisthobranch gastropod mollusk in the family Aplysiidae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesSeaLifeBase
Size & morphology2
Body length40 cm
Body mass1 710 g
Life cycle & reproduction1
Max. longevity12 months
Habitat & environment2
Habitat saltwateryes
Habitat zonebenthic
Other traits2
Depth max13 m
Depth min0 m
03Chemical composition34 compounds
Compounds documented for Aplysia fasciata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Brasilane sesquiterpenoids8
Carotenoids (C40, β-β)4
Xenicane diterpenoids3
Carotenoids (C40, β-ε)3
Parguerane diterpenoids3
Documented compounds34 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R*,4R*,5Z,9S*)-5-isopropyl-3,3,9-trimethylbicyclo(4.3.0)nona-5-en-4-ol | present | LOTUS | |
| (1R,2R,4R,8S,12R)-1-methyl-2-[(2S)-6-methylhept-5-en-2-yl]-5-oxatricyclo[6.3.1.04,12]dodecane-6,9-dione | present | LOTUS | |
| (1R,2S,3S,4S)-4-bromo-2-[(3S)-3-hydroxy-3-methylpent-4-enyl]-1,3-dimethyl-3-(4-methylpent-3-enyl)cyclohexan-1-ol | present | LOTUS | |
| (1R,3aS,4R)-1,6,6-trimethyl-4-propan-2-yl-2,3,4,5-tetrahydro-1H-inden-3a-ol | present | LOTUS | |
| (1S,5R,7aR)-1,6,6-trimethyl-4-propan-2-yl-1,2,3,5,7,7a-hexahydroinden-5-ol | present | LOTUS | |
| (2R,3R,5E,8R)-3-chloro-2-[(E)-pent-2-en-4-ynyl]-8-[(E)-prop-1-enyl]-3,4,7,8-tetrahydro-2H-oxocine | present | LOTUS | |
| (2R,3R,5Z,7Z)-3-chloro-2-[(Z)-pent-2-en-4-ynyl]-8-propyl-3,4-dihydro-2H-oxocine | present | LOTUS | |
| (2S,3S,5Z,7Z)-3-chloro-2-[(Z)-pent-2-en-4-ynyl]-8-propyl-3,4-dihydro-2H-oxocine | present | LOTUS | |
| (2S,3S,5Z,8S)-8-[(1R)-1-bromopropyl]-3-chloro-2-[(Z)-pent-2-en-4-ynyl]-3,4,7,8-tetrahydro-2H-oxocine | present | LOTUS | |
| (3R,4R,7R)-3,5,5-trimethyl-7-propan-2-yl-1,2,3,4,6,7-hexahydroinden-4-ol | present | LOTUS |
05DNA & barcoding11 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplysia fasciata has left across the world's sequence archives.
At a glance
DNA specimens11
BINs2
Marker genes1
eDNA detections17
Countries4
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P655 bp consensus11 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 80% of positions are identical in every specimen.
Where individuals differ — all 133 variable positions, in barcode order
2Amostly conserved
3Cmostly conserved
6Tmostly conserved
7Amostly conserved
8Tmostly conserved
9Amostly conserved
10Cmostly conserved
13Amostly conserved
14Amostly conserved
16Tmostly conserved
17Tmostly conserved
18Tmostly conserved
19Tmostly conserved
20Gmostly conserved
21Gmostly conserved
22Amostly conserved
23Amostly conserved
24Tmostly conserved
25Gmostly conserved
28Amostly conserved
29Tmostly conserved
32Gmostly conserved
33Gmostly conserved
34Tmostly conserved
35Tvariable
39Tmostly conserved
40Amostly conserved
41Gmostly conserved
42Gmostly conserved
43Amostly conserved
44Amostly conserved
45Cmostly conserved
46Gvariable
47Gmostly conserved
48Gmostly conserved
49Tmostly conserved
50Tmostly conserved
51Tmostly conserved
52Amostly conserved
53Amostly conserved
54Gmostly conserved
56Cmostly conserved
58Tmostly conserved
59Tmostly conserved
61Amostly conserved
62Amostly conserved
63Tmostly conserved
64Tmostly conserved
65Cmostly conserved
66Gmostly conserved
67Amostly conserved
68Tmostly conserved
69Tmostly conserved
70Tmostly conserved
71Gmostly conserved
72Amostly conserved
73Gmostly conserved
74Cmostly conserved
75Tmostly conserved
77Gmostly conserved
78Gmostly conserved
80Amostly conserved
84Cmostly conserved
85Tmostly conserved
87Gmostly conserved
88Amostly conserved
89Gmostly conserved
90Cmostly conserved
91Tmostly conserved
92Tmostly conserved
94Cmostly conserved
95Cmostly conserved
96Tmostly conserved
97Amostly conserved
99Gmostly conserved
100Gmostly conserved
112Cmostly conserved
136Cmostly conserved
142Cmostly conserved
154Tmostly conserved
157Tmostly conserved
166Gmostly conserved
184Amostly conserved
187Tmostly conserved
206Tmostly conserved
208Amostly conserved
209Tmostly conserved
229Gmostly conserved
232Amostly conserved
235Tmostly conserved
237Cmostly conserved
247Cmostly conserved
250Cmostly conserved
271Tmostly conserved
277Cmostly conserved
280Tmostly conserved
281Tmostly conserved
294Tmostly conserved
346Cmostly conserved
349Gmostly conserved
355Tmostly conserved
382Tmostly conserved
385Tmostly conserved
391Tmostly conserved
400Cmostly conserved
406Cmostly conserved
407Cmostly conserved
415Gmostly conserved
424Amostly conserved
451Tmostly conserved
460Tmostly conserved
472Gmostly conserved
481Tmostly conserved
487Tmostly conserved
499Cmostly conserved
505Tmostly conserved
517Tmostly conserved
523Amostly conserved
529Tmostly conserved
532Cmostly conserved
+13 more variable positions not shown
AACATTATACATAATTTTTGGAATGTGATGTGGTTTAGTAGGAACGGGTTTAAGTCTTTTAATTCGATTTGAGCTTGGTACTGCTGGAGC …
Variant network
Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.
Diversity (π)5.7%
Haplotypes5
BINs2
Most divergent pair0.31%
EuropeAsiaS.America
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P
animal barcode
08Occurrence & distribution
Record type1 641 records
Wild obs. + sensor1 311
Museum / vouchered216
Other114
Origin
Native5
Range
Area of Occupancy AOO2 972 km²
Depth
0–200 m sunlit77
200–1000 m twilight0
1–4 km midnight0
>4 km abyssal0
median 6.5 m · max 140 m · 77 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy87% within 1 km
≤100 m 559≤1 km 240≤10 km 92>10 km 32
923 georeferenced · 388 without coordinates
Open the mapobservation + sensor1 311
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy28% within 1 km
≤100 m 5≤1 km 7≤10 km 13>10 km 18
43 georeferenced · 173 without coordinates
Open the institutions mapphysical evidence216
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions8 of 23 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record | 20 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 16 |
| Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record | 13 |
| North Carolina Museum of Natural Scienceslocation not on record | 12 |
| Philadelphia, US | 10 |
| Natural History Museum Rotterdamlocation not on record | 8 |
| AUTHlocation not on record | 5 |
| Brussels, BE | 4 |
| RBINS-Scientific Heritagelocation not on record | 4 |
| Chicago, US | 4 |
| Santa Barbara Museum of Natural Historylocation not on record | 4 |
| Washington, US | 2 |
| New Haven, US | 2 |
| Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record | 2 |
| Helsinki, FI | 2 |
| National Marine Biodiversity Institute of Korealocation not on record | 1 |
| Los Angeles, US | 1 |
| Turkmen Agricultural University named after S.A. Niyazovlocation not on record | 1 |
| Museo Nacional de Ciencias Naturales (CSIC)location not on record | 1 |
| Universidad El Bosque (El Bosque)location not on record | 1 |
| Alabama Museum of Natural Historylocation not on record | 1 |
| Cambridge, US | 1 |
| CASlocation not on record | 1 |
23 institutions · 116 of 216 vouchered records shown · 6 without an institution code
09Environmental DNA17 detections
Where the DNA of Aplysia fasciata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found17
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 17 detections have coordinates
Open the map4 countries0
Shallow waterMarine area, shallow depthAlgae Farm
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median25.1 °C 19.1–26.9
Seasonal swing summer↔winter4.90 °C
Max temp (day)29.1 °C 20.8–30.2
Min temp (night)21.3 °C 17.8–25.7
Precipitation164 mm/mo 17.9–206
Air humidity64.0 % 60.3–64.0
Moisture balance32.9 mm/mo
Vapour deficit1,154 Pa 898–1,273
Wind speed1.90 m/s
Cloud cover43.2 % 31.5–45.9
CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.