Aplysia morio

(A.E.Verrill, 1901) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Aplysiida/Aplysiidae/Aplysia

At a glance

Occurrence records361

Data sources7

Biological traits2

DNA specimens16

eDNA detections2

Sources7 archives

Databases and archives Aplysia morio's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility267 records↗

OBISOcean Biodiversity Information System94 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS361 records

Environmental DNA2 datasets · 1 countries2 detections

DNA & barcodingBOLD16 specimens

01Narrative

Aplysia morio, the Atlantic black sea hare or sooty sea hare, is a species of sea slug, a marine gastropod mollusk in the family Aplysiidae, the sea hares. It lives in warm waters in the Caribbean Sea and off the south and southeastern coast of the United States, where it feeds on seaweed.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplysia morio has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 88 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

6Tmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

10Tmostly conserved

13Amostly conserved

14Amostly conserved

16Tmostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Amostly conserved

23Amostly conserved

24Tmostly conserved

25Gmostly conserved

28Amostly conserved

29Tmostly conserved

32Gmostly conserved

33Gmostly conserved

34Tmostly conserved

35Cmostly conserved

37Amostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

44Amostly conserved

45Cmostly conserved

46Amostly conserved

47Gmostly conserved

48Gmostly conserved

49Tmostly conserved

50Tmostly conserved

51Tmostly conserved

52Amostly conserved

53Amostly conserved

54Gmostly conserved

56Cmostly conserved

58Tmostly conserved

59Tmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Amostly conserved

68Tmostly conserved

69Tmostly conserved

70Tmostly conserved

71Gmostly conserved

72Amostly conserved

73Gmostly conserved

74Cmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

80Amostly conserved

82Tmostly conserved

84Cmostly conserved

85Cmostly conserved

87Gmostly conserved

88Amostly conserved

89Gmostly conserved

90Cmostly conserved

91Tmostly conserved

92Tmostly conserved

94Cmostly conserved

95Cmostly conserved

96Tmostly conserved

97Amostly conserved

99Gmostly conserved

100Gmostly conserved

103Tmostly conserved

118Tmostly conserved

223Cmostly conserved

286Tmostly conserved

322Amostly conserved

355Cvariable

358Cvariable

433Tmostly conserved

500Cmostly conserved

517Tmostly conserved

646Cvariable

649Gvariable

AACATTATATATAATTTTTGGAATGTGATGTGGTCTAGTAGGAACAGGTTTAAGTCTTTTAATTCGATTTGAGCTTGGTACTGCCGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes6

BIN1

Most divergent pair1.1%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aplysia californicasame genus8.1%Aplysia kurodaisame genus8.4%Aplysia dactylomelasame genus9.5%Aplysia fasciatasame genus9.5%Aplysia brasilianasame genus9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type361 records

Wild obs. + sensor169

Museum / vouchered192

Origin

Native2

Range

Area of Occupancy AOO784 km²

Depth

0–200 m sunlit76

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 37.9 m · max 74.1 m · 76 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 83≤1 km 34≤10 km 11>10 km 15

143 georeferenced · 26 without coordinates

Open the mapobservation + sensor169

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 2≤1 km 5≤10 km 3

10 georeferenced · 182 without coordinates

Open the institutions mapphysical evidence192

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institutelocation not on record	6
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	3
Chongqing Museumlocation not on record	3
Alabama Museum of Natural Historylocation not on record	2
UM-RSMASlocation not on record	2
Texas Cooperative Wildlife Collectionlocation not on record	2
Washington, US	2
Chicago, US	1

8 institutions · 21 of 192 vouchered records shown · 82 without an institution code

09Environmental DNA2 detections

Where the DNA of Aplysia morio was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys2

Countries1

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 23.3–26.5

Seasonal swing summer↔winter7.20 °C

Max temp (day)25.8 °C 24.2–27.3

Min temp (night)24.1 °C 22.5–25.6

Precipitation99.8 mm/mo 68.3–131

Air humidity61.9 % 59.9–63.9

Vapour deficit1,196 Pa 1,147–1,246

Cloud cover32.0 % 31.9–32.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)