Aplysia brasiliana

Rang, 1828 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Aplysiida/Aplysiidae/Aplysia

At a glance

Occurrence records815

Data sources7

Biological traits5

DNA specimens11

eDNA detections2

Sources7 archives

Databases and archives Aplysia brasiliana's data was compiled from.

GBIFGlobal Biodiversity Information Facility656 records↗

OBISOcean Biodiversity Information System159 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources5 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF · OBIS815 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD11 specimens

02Traits & measurements

SourcesSeaLifeBase

Size & morphology2

Body length27 cm

Body mass608 g

Life cycle & reproduction1

Max. longevity12 months

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

03Chemical composition5 compounds

Compounds documented for Aplysia brasiliana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Brasilane sesquiterpenoids4

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3aR,8bR)-2-(3-bromopropa-1,2-dienyl)-8-ethyl-2,3,3a,8b-tetrahydrofuro[3,2-b][1]benzofuran	present	LOTUS
(3R,4R,7R)-3,5,5-trimethyl-7-propan-2-yl-1,2,3,4,6,7-hexahydroinden-4-ol	present	LOTUS
(3R,4S,7R)-3,5,5-trimethyl-7-propan-2-yl-1,2,3,4,6,7-hexahydroinden-4-ol	present	LOTUS
3,5,5-Trimethyl-7-propan-2-yl-1,2,3,4,6,7-hexahydroinden-4-ol	present	LOTUS
[(3R,4S,7R)-3,5,5-trimethyl-7-propan-2-yl-1,2,3,4,6,7-hexahydroinden-4-yl] acetate	present	LOTUS

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplysia brasiliana has left across the world's sequence archives.

At a glance

DNA specimens11

BINs3

Marker genes1

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 72 variable positions, in barcode order

10Cmostly conserved

35Tmostly conserved

40Amostly conserved

46Gvariable

85Tmostly conserved

142Cmostly conserved

157Cmostly conserved

166Gmostly conserved

187Tmostly conserved

190Gvariable

208Amostly conserved

209Tmostly conserved

220Tmostly conserved

223Tmostly conserved

229Gmostly conserved

247Cvariable

253Gmostly conserved

265Tmostly conserved

277Cmostly conserved

280Tmostly conserved

281Tmostly conserved

301Amostly conserved

302Cmostly conserved

313Tmostly conserved

316Amostly conserved

337Tmostly conserved

340Tmostly conserved

346Cmostly conserved

352Amostly conserved

355Tmostly conserved

358Tmostly conserved

370Amostly conserved

373Amostly conserved

382Tmostly conserved

397Tmostly conserved

406Cmostly conserved

407Cvariable

409Amostly conserved

418Gvariable

424Amostly conserved

427Tmostly conserved

430Amostly conserved

442Tmostly conserved

451Tmostly conserved

481Tmostly conserved

494Tmostly conserved

499Cmostly conserved

500Tmostly conserved

505Tmostly conserved

517Tmostly conserved

520Gmostly conserved

526Amostly conserved

532Cmostly conserved

544Cmostly conserved

548Cmostly conserved

553Amostly conserved

557Cmostly conserved

560Gmostly conserved

562Tmostly conserved

580Tmostly conserved

586Tmostly conserved

598Tmostly conserved

604Gmostly conserved

610Cmostly conserved

613Tmostly conserved

616Tmostly conserved

628Gvariable

631Amostly conserved

646Tmostly conserved

649Amostly conserved

655Gmostly conserved

658Cmostly conserved

AACATTATACATAATTTTTGGAATGTGATGTGGTTTAGTAGGAACGGGTTTAAGTCTTTTAATTCGATTTGAGCTTGGTACTGCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.7%

Haplotypes4

BINs3

Most divergent pair9.9%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aplysia californicasame genus4.1%Aplysia kurodaisame genus8.2%Aplysia dactylomelasame genus8.5%Aplysia argussame genus8.7%Aplysia moriosame genus9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type815 records

Wild obs. + sensor676

Museum / vouchered121

Other18

Range

Area of Occupancy AOO1 692 km²

Depth

0–200 m sunlit119

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1.5 m · max 27.4 m · 119 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 472≤1 km 83≤10 km 44>10 km 16

615 georeferenced · 61 without coordinates

Open the mapobservation + sensor676

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 3≤1 km 1≤10 km 4

8 georeferenced · 113 without coordinates

Open the institutions mapphysical evidence121

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	9
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	7
Washington, US	6
Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institutelocation not on record	5
Philadelphia, US	3
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	2
Delaware Museum of Nature and Sciencelocation not on record	2
Chicago, US	2
Universidad El Bosque (El Bosque)location not on record	1
Cambridge, US	1
Mexico City, MX	1
CASlocation not on record	1
Los Angeles, US	1
UNICAMPlocation not on record	1

14 institutions · 42 of 121 vouchered records shown · 22 without an institution code

09Environmental DNA2 detections

Where the DNA of Aplysia brasiliana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 25.0–26.7

Seasonal swing summer↔winter10.4 °C

Max temp (day)27.8 °C 27.4–28.1

Min temp (night)24.2 °C 22.9–25.5

Precipitation128 mm/mo 70.1–185

Air humidity63.3 % 62.4–64.2

Vapour deficit1,219 Pa 1,186–1,252

Cloud cover31.9 % 31.5–32.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)