Aplysia argus

Rüppell & Leuckart, 1830 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Aplysiida/Aplysiidae/Aplysia

At a glance

Occurrence records3 046

Data sources9

Biological traits2

DNA specimens4

eDNA detections0

Sources9 archives

Databases and archives Aplysia argus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 939 records↗

OBISOcean Biodiversity Information System107 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS · NPASS30 compounds

Occurrence & distributionGBIF · OBIS3 046 records

DNA & barcodingBOLD4 specimens

01Narrative

Aplysia argus is a species of gastropod mollusc in the genus Aplysia, native to the Indo-Pacific region.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

03Chemical composition30 compounds

Compounds documented for Aplysia argus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Isocoumarins3

Azaphilones2

Cyclic peptides $ Depsipeptides $ Lipopeptides2

Tetraketide meroterpenoids2

Quinazoline alkaloids1

Documented compounds30 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,12R)-1-methyl-3,13,21,23-tetrazahexacyclo[10.10.2.02,10.04,9.013,22.015,20]tetracosa-2(10),4,6,8,15,17,19,21-octaene-14,24-dione	present	NPASS
(1S,4S,5S,6R,9S)-9-bromo-4-[[(1S,4S)-4-bromo-1-hydroxy-3,3-dimethylcyclohexyl]methyl]-6-methyl-11-oxatricyclo[4.3.2.01,5]undecan-10-one	present	LOTUS
(2S,3R)-2,3,4-trimethyl-2,3-dihydro-1-benzofuran-5,7-diol	present	NPASS
(3S,6S,9R,12S,19S)-3-benzyl-19-[(2S)-hexan-2-yl]-6-methyl-9-(2-methylpropyl)-12-propan-2-yl-1-oxa-4,7,10,13,16-pentazacyclononadecane-2,5,8,11,14,17-hexone	present	NPASS
2,6-dihydroxy-4-[(2R,3R)-3-hydroxybutan-2-yl]-3-methylbenzoic acid	present	NPASS
2-[[2-[(3-Pyridinylcarbonyl)amino]benzoyl]amino]-3,4,5-trimethoxybenzoic acid methyl ester	present	NPASS
3'-O-Acetyl-2'-Deoxythymidine	present	NPASS
Aplysistatin	present	LOTUS
Austalide P	present	NPASS
Austalide Q	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplysia argus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

10Tmostly conserved

59Cvariable

178Cvariable

262Avariable

401Cvariable

502Avariable

AACATTATATATAATTTTTGGGATGTGATGTGGTTTGGTAGGTACAGGTTTGAGTCTTCTAATTCGATTCGAATTAGGTACTGCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.58%

Haplotypes3

BIN1

Most divergent pair0.91%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aplysia dactylomelasame genus5.5%Aplysia californicasame genus8.2%Aplysia fasciatasame genus8.4%Aplysia brasilianasame genus8.7%Aplysia kurodaisame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_063768 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1ND6ND5ND1ND4LCYTBCOX2ATP8ATP6ND3ND4COX3ND2rrn16rrn12

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type3 046 records

Wild obs. + sensor2 912

Museum / vouchered134

Range

Area of Occupancy AOO2 872 km²

Depth

0–200 m sunlit18

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2.5 m · max 15 m · 18 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 1 401≤1 km 618≤10 km 152>10 km 69

2 240 georeferenced · 672 without coordinates

Open the mapobservation + sensor2 912

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 12≤1 km 22≤10 km 15>10 km 2

51 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence134

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Western Australian Museumlocation not on record	39
Sydney, AU	33
Museums Victorialocation not on record	21
QVMAGlocation not on record	8
Auckland, NZ	8
Natick, US	6
Washington, US	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Earth Sciences New Zealandlocation not on record	2
Museum and Art Gallery of the Northern Territorylocation not on record	1
Brussels, BE	1
Tasmanian Museum & Art Gallerylocation not on record	1
Los Angeles, US	1

13 institutions · 127 of 134 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aplysia argus

At a glance

Sources9 archives

Habitat & environment2

Compound class profile5 classes

Documented compounds30 total

At a glance

Record type3 046 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 13 geolocated

Record type3 046 records