Aphrodes makarovi

Zakhvatkin, 1948 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Aphrodes

At a glance

Occurrence records4 052

Data sources6

Biological traits2

DNA specimens219

eDNA detections394

Sources6 archives

Databases and archives Aphrodes makarovi's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility4 052 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI394 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics219 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 052 records

Environmental DNA5 datasets · 14 countries394 detections

DNA & barcodingBOLD219 specimens

01Narrative

Video einer Kopula (2 min 31 s) Die Wiesen-Erdzikade (Aphrodes makarovi) ist eine Zwergzikade aus der Unterfamilie der Erdzikaden (Aphrodinae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding219 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphrodes makarovi has left across the world's sequence archives.

At a glance

DNA specimens219

BINs2

Marker genes1

eDNA detections394

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P645 bp consensus192 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

18Gmostly conserved

28Tmostly conserved

33Tmostly conserved

39Gmostly conserved

57Tmostly conserved

171Cmostly conserved

312Tmostly conserved

474Gvariable

568Tvariable

606Cvariable

618Amostly conserved

TTCATTTTTGGGTTATGGTCTGGTATATTGGGTATGATGCTTAGATTTATTATTCGTATTGAACTTTCACAACCAGGTTCATTTTTGGGG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes20

BINs2

Most divergent pair7.0%

EuropeN.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphrodes bicinctasame genus4.0%Aphrodes diminutasame genus6.7%Anoscopus flavostriatussame family12.6%Anoscopus serratulaesame family13.0%Anoscopus albigersame family13.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 052 records

Wild obs. + sensor3 470

Museum / vouchered555

Cultivated / captive2

Other25

Range

Area of Occupancy AOO8 488 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 1 795≤1 km 434≤10 km 571>10 km 3

2 803 georeferenced · 667 without coordinates

Open the mapobservation + sensor3 470

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy99% within 1 km

≤100 m 241≤1 km 48≤10 km 3

292 georeferenced · 263 without coordinates

Open the institutions mapphysical evidence555

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	111
University of Guelph, Centre for Biodiversity Genomicslocation not on record	67
Museo universitario di Scienze della Terra di Romalocation not on record	43
NHMOlocation not on record	17
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	11
Tilburg, NL	11
Natural History Museum Rotterdamlocation not on record	11
neflocation not on record	9
Philadelphia, US	8
Metsähallituslocation not on record	7
Champaign, US	7
BioFokuslocation not on record	6
Trondheim, NO	3
Bavarian State Collection of Zoologylocation not on record	3
Natural History Museum, Rangoonlocation not on record	3
NTNU-VMlocation not on record	1
Jyväskylä, FI	1
University of Oululocation not on record	1

18 institutions · 320 of 555 vouchered records shown · 235 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA394 detections

Where the DNA of Aphrodes makarovi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found394

Studies independent surveys5

Countries14

Verifiable raw sequence linked78

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 394 detections have coordinates

Open the map14 countries0

ForestUrbanWetland4. Native GrasslandGrasslandMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 13.2–20.2

Seasonal swing summer↔winter19.8 °C

Max temp (day)20.0 °C 15.0–24.2

Min temp (night)12.6 °C 8.00–15.9

Precipitation84.7 mm/mo 35.5–141

Air humidity60.3 % 55.1–63.4

Moisture balance-49.6 mm/mo -97.2–17.4

Vapour deficit724 Pa 566–963

Wind speed3.70 m/s 2.50–5.50

Cloud cover41.1 % 33.5–49.3

CHELSA 1981–2010, ~9 km grid, at location & month of 354 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphrodes makarovi

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type4 052 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions5 of 18 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 052 records