Aphrodes diminuta

Ribaut, 1952 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Aphrodes

At a glance

Occurrence records376

Data sources5

Biological traits0

DNA specimens36

eDNA detections84

Sources5 archives

Databases and archives Aphrodes diminuta's data was compiled from.

GBIFGlobal Biodiversity Information Facility376 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI84 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF376 records

Environmental DNA5 datasets · 5 countries84 detections

DNA & barcodingBOLD36 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphrodes diminuta has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes1

eDNA detections84

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P600 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

20Cmostly conserved

69Gmostly conserved

99Cmostly conserved

123Amostly conserved

183Cmostly conserved

213Tmostly conserved

258Cmostly conserved

375Cmostly conserved

390Cmostly conserved

408Gmostly conserved

434Gmostly conserved

435Gmostly conserved

561Cvariable

570Gmostly conserved

ATTATTCGTATTGAACTTTCACAACCAGGGTCATTTCTGGGGAATGACCAAATTTATAATGTAGTTGTGACATCTCATGCATTTGTAATG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.61%

Haplotypes5

BIN1

Most divergent pair0.50%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphrodes bicinctasame genus6.3%Aphrodes makarovisame genus6.7%Anoscopus assimilissame family13.8%Anoscopus serratulaesame family13.9%Anoscopus histrionicussame family14.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type376 records

Wild obs. + sensor228

Museum / vouchered148

Range

Area of Occupancy AOO888 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 125≤1 km 27≤10 km 9

161 georeferenced · 67 without coordinates

Open the mapobservation + sensor228

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 101≤1 km 11≤10 km 3

115 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence148

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
SLU Artdatabankenlocation not on record	11
Metsähallituslocation not on record	8
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
BioFokuslocation not on record	4
Natural History Museum, Rangoonlocation not on record	2
Centre for Biodiversity Genomicslocation not on record	1

6 institutions · 30 of 148 vouchered records shown · 118 without an institution code

09Environmental DNA84 detections

Where the DNA of Aphrodes diminuta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found84

Studies independent surveys5

Countries5

Verifiable raw sequence linked32

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 84 detections have coordinates

Open the map5 countries0

Temperate mixed forest1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.5 °C 11.8–17.2

Seasonal swing summer↔winter19.8 °C

Max temp (day)19.2 °C 14.1–20.9

Min temp (night)11.0 °C 8.90–15.9

Precipitation103 mm/mo 55.2–141

Air humidity62.9 % 60.4–63.6

Moisture balance17.4 mm/mo -74.0–42.2

Vapour deficit645 Pa 548–762

Wind speed3.80 m/s 2.60–5.10

Cloud cover41.4 % 33.5–55.3

CHELSA 1981–2010, ~9 km grid, at location & month of 71 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)