Anoscopus serratulae

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Anoscopus

At a glance

Occurrence records737

Data sources5

Biological traits2

DNA specimens34

eDNA detections129

Sources5 archives

Databases and archives Anoscopus serratulae's data was compiled from.

GBIFGlobal Biodiversity Information Facility737 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI129 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF737 records

Environmental DNA4 datasets · 5 countries129 detections

DNA & barcodingBOLD34 specimens

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoscopus serratulae has left across the world's sequence archives.

At a glance

DNA specimens34

BINs1

Marker genes1

eDNA detections129

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

105Cmostly conserved

141Tmostly conserved

213Amostly conserved

222Cmostly conserved

293Cmostly conserved

546Tmostly conserved

ACTTTATATTTCATTTTTGGTTTATGATCTGGTATACTGGGAATAATACTTAGATTAATTATTCGTATTGAACTATCTCAACCAGGTTCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.24%

Haplotypes3

BIN1

Most divergent pair0.76%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anoscopus albigersame genus8.7%Anoscopus flavostriatussame genus9.3%Anoscopus histrionicussame genus10.5%Anoscopus assimilissame genus11.7%Aphrodes hamiltonisame family12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type737 records

Wild obs. + sensor532

Museum / vouchered205

Range

Area of Occupancy AOO1 572 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 239≤1 km 85≤10 km 77>10 km 19

420 georeferenced · 112 without coordinates

Open the mapobservation + sensor532

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 6≤1 km 2≤10 km 2

10 georeferenced · 195 without coordinates

Open the institutions mapphysical evidence205

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	146
University of Guelphlocation not on record	24
Champaign, US	13
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
Stockholm, SE	1
Tartu, EE	1
SLU Artdatabankenlocation not on record	1

8 institutions · 190 of 205 vouchered records shown · 15 without an institution code

09Environmental DNA129 detections

Where the DNA of Anoscopus serratulae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found129

Studies independent surveys4

Countries5

Verifiable raw sequence linked97

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 129 detections have coordinates

Open the map5 countries0

Grassland4. Native GrasslandWetlandfreshwater stream, and mediterranean climate…farm1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 16.9–20.0

Seasonal swing summer↔winter17.5 °C

Max temp (day)20.9 °C 18.2–25.6

Min temp (night)13.0 °C 12.9–15.6

Precipitation103 mm/mo 47.7–103

Air humidity60.8 % 57.7–61.6

Moisture balance-27.3 mm/mo -95.2–-27.3

Vapour deficit762 Pa 741–1,038

Wind speed3.60 m/s 2.70–5.10

Cloud cover50.5 % 36.4–50.5

CHELSA 1981–2010, ~9 km grid, at location & month of 123 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)