Anoscopus flavostriatus

(Donovan, 1799) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Anoscopus

At a glance

Occurrence records850

Data sources5

Biological traits2

DNA specimens102

eDNA detections309

Sources5 archives

Databases and archives Anoscopus flavostriatus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility850 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI309 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics102 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF850 records

Environmental DNA4 datasets · 6 countries309 detections

DNA & barcodingBOLD102 specimens

01Narrative

Anoscopus flavostriatus is a species of leafhoppers belonging to the family Cicadellidae. It is native to Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding102 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoscopus flavostriatus has left across the world's sequence archives.

At a glance

DNA specimens102

BINs1

Marker genes1

eDNA detections309

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P643 bp consensus89 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

64Cmostly conserved

103Cmostly conserved

139Cmostly conserved

220Gmostly conserved

250Gmostly conserved

259Gmostly conserved

283Amostly conserved

418Amostly conserved

490Gmostly conserved

595Gvariable

628Avariable

634Tmostly conserved

TTTATATTTCATTTTCGGTTTATGGTCTGGTATGCTGGGTATAATACTTAGACTAATTATTCGCATTGAACTATCTCAACCAGGTTCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes12

BIN1

Most divergent pair2.3%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anoscopus albigersame genus6.5%Anoscopus serratulaesame genus9.3%Anoscopus histrionicussame genus10.3%Aphrodes makarovisame family12.6%Aphrodes bicinctasame family13.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type850 records

Wild obs. + sensor523

Museum / vouchered318

Cultivated / captive1

Other8

Range

Area of Occupancy AOO1 900 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 288≤1 km 57≤10 km 86

431 georeferenced · 92 without coordinates

Open the mapobservation + sensor523

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 72≤1 km 26≤10 km 10

108 georeferenced · 210 without coordinates

Open the institutions mapphysical evidence318

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	58
University of Guelph, Centre for Biodiversity Genomicslocation not on record	51
Champaign, US	22
Metsähallituslocation not on record	13
SLU Artdatabankenlocation not on record	12
Museo universitario di Scienze della Terra di Romalocation not on record	8
Philadelphia, US	7
Tartu, EE	6
CBDClocation not on record	5
NHMOlocation not on record	5
BioFokuslocation not on record	3
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
Centre for Biodiversity Genomicslocation not on record	2
Natural History Museum, Rangoonlocation not on record	2
Biodiversity Institute of Ontariolocation not on record	1
Helsinki, FI	1
Tromsø, NO	1

17 institutions · 199 of 318 vouchered records shown · 119 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA309 detections

Where the DNA of Anoscopus flavostriatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found309

Studies independent surveys4

Countries6

Verifiable raw sequence linked206

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 309 detections have coordinates

Open the map6 countries0

ForestUrban1. Forest & Woodland | 1.4. Temperate Forestfarm14. Artificial - Terrestrial|14.1 Arable Land4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 16.0–19.2

Seasonal swing summer↔winter18.3 °C

Max temp (day)20.8 °C 20.0–25.1

Min temp (night)13.5 °C 10.8–15.5

Precipitation81.7 mm/mo 66.3–103

Air humidity60.7 % 57.0–60.8

Moisture balance-42.9 mm/mo -66.1–-23.7

Vapour deficit762 Pa 735–949

Wind speed3.60 m/s 2.40–4.10

Cloud cover49.0 % 39.6–51.8

CHELSA 1981–2010, ~9 km grid, at location & month of 303 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)