Anoscopus albiger

(Germar, 1821) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Anoscopus

At a glance

Occurrence records94

Data sources5

Biological traits2

DNA specimens17

eDNA detections24

Sources5 archives

Databases and archives Anoscopus albiger's data was compiled from.

GBIFGlobal Biodiversity Information Facility94 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF94 records

Environmental DNA4 datasets · 4 countries24 detections

DNA & barcodingBOLD17 specimens

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoscopus albiger has left across the world's sequence archives.

At a glance

DNA specimens17

BINs3

Marker genes1

eDNA detections24

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P601 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 40 variable positions, in barcode order

13Gmostly conserved

34Amostly conserved

52Tmostly conserved

70Cvariable

73Amostly conserved

76Amostly conserved

79Tvariable

103Tvariable

142Avariable

166Amostly conserved

188Tmostly conserved

190Amostly conserved

193Amostly conserved

196Tmostly conserved

199Amostly conserved

211Cvariable

247Amostly conserved

253Amostly conserved

262Amostly conserved

266Cmostly conserved

316Cvariable

322Cmostly conserved

349Cmostly conserved

376Cvariable

379Gvariable

382Tmostly conserved

383Tmostly conserved

409Tvariable

451Tmostly conserved

454Amostly conserved

499Amostly conserved

514Amostly conserved

520Tvariable

532Avariable

541Gmostly conserved

554Tmostly conserved

559Amostly conserved

568Amostly conserved

577Cmostly conserved

601Avariable

ATGGTCTGGTATGCTGGGTATAATACTTAGACTAATTATTCGTATTGAACTTTCTCAACCAGGTTCATTCTTAGGAAATGACCAAATTTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes4

BINs3

Most divergent pair5.8%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anoscopus flavostriatussame genus6.5%Anoscopus serratulaesame genus8.7%Anoscopus histrionicussame genus9.2%Anoscopus assimilissame genus11.1%Anoscopus albifronssame genus11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type94 records

Wild obs. + sensor57

Museum / vouchered37

Range

Area of Occupancy AOO220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 25≤1 km 13≤10 km 13

51 georeferenced · 6 without coordinates

Open the mapobservation + sensor57

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 6≤1 km 6≤10 km 15

27 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	28
CBDClocation not on record	2

2 institutions · 30 of 37 vouchered records shown · 7 without an institution code

09Environmental DNA24 detections

Where the DNA of Anoscopus albiger was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys4

Countries4

Verifiable raw sequence linked8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map4 countries0

4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 12.4–17.0

Seasonal swing summer↔winter17.5 °C

Max temp (day)20.2 °C 15.9–20.9

Min temp (night)13.0 °C 8.40–15.6

Precipitation66.4 mm/mo 54.7–103

Air humidity60.8 % 53.7–62.3

Moisture balance-27.3 mm/mo -86.1–-17.1

Vapour deficit762 Pa 550–776

Wind speed3.60 m/s 2.20–5.10

Cloud cover45.2 % 39.6–50.5

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)