Anoscopus albifrons

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Anoscopus

At a glance

Occurrence records2 302

Data sources7

Biological traits2

DNA specimens35

eDNA detections2

Sources7 archives

Databases and archives Anoscopus albifrons's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 302 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 302 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD35 specimens

01Narrative

Anoscopus albifrons is a species of insect in the family Cicadellidae. It was first described by Carl Linnaeus in 1758, in the 10th Edition of his Systema Naturae. It is found throughout Europe, the Azores, and parts of the United States and Canada. It inhabits grassy areas and forbs.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoscopus albifrons has left across the world's sequence archives.

At a glance

DNA specimens35

BINs1

Marker genes1

eDNA detections2

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P639 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.4%

Haplotypes2

BIN1

Most divergent pair13.9%

Where individuals differ — all 16 variable positions, in barcode order

9Tmostly conserved

12Amostly conserved

180Gvariable

268Cmostly conserved

277Cmostly conserved

324Cmostly conserved

435Cmostly conserved

468Gmostly conserved

552Tmostly conserved

588Amostly conserved

597Tmostly conserved

612Gmostly conserved

615Tmostly conserved

618Amostly conserved

621Tmostly conserved

624Cmostly conserved

TTCATTTTTGGATTATGATCAGGTATACTGGGTATAATACTTAGATTAATTATTCGTATTGAATTATCTCAACCAGGTTCATTTTTAGGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anoscopus assimilissame genus1.9%Aphrodes hamiltonisame family10.5%Anoscopus histrionicussame genus10.8%Anoscopus albigersame genus11.6%Anoscopus serratulaesame genus12.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 302 records

Wild obs. + sensor1 736

Museum / vouchered560

Cultivated / captive1

Fossil4

Other1

Origin

Native174

Introduced6

Range

Area of Occupancy AOO3 864 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 780≤1 km 649≤10 km 215>10 km 6

1 650 georeferenced · 86 without coordinates

Open the mapobservation + sensor1 736

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 254≤1 km 28≤10 km 28

310 georeferenced · 250 without coordinates

Open the institutions mapphysical evidence560

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum, Rangoonlocation not on record	189
UAclocation not on record	180
SLU Artdatabankenlocation not on record	43
CBDClocation not on record	27
Tartu, EE	17
University of Guelph, Centre for Biodiversity Genomicslocation not on record	15
Museo universitario di Scienze della Terra di Romalocation not on record	12
NHMOlocation not on record	5
Metsähallituslocation not on record	4
BioFokuslocation not on record	2
Philadelphia, US	2
Paris, FR	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
Research Collection of Teemu Rintalalocation not on record	1
Tilburg, NL	1
Bavarian State Collection of Zoologylocation not on record	1

16 institutions · 501 of 560 vouchered records shown · 59 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Anoscopus albifrons was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 15.0–17.3

Seasonal swing summer↔winter21.6 °C

Max temp (day)20.0 °C 18.4–21.6

Min temp (night)12.3 °C 12.0–12.5

Precipitation94.8 mm/mo 93.8–95.8

Air humidity60.3 % 58.8–61.8

Moisture balance-6.40 mm/mo -25.2–12.3

Vapour deficit740 Pa 658–823

Wind speed2.80 m/s 2.50–3.20

Cloud cover43.5 % 37.2–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anoscopus albifrons

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type2 302 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions4 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 302 records