Anthrenus lepidus

LeConte, 1854 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Dermestidae/Anthrenus

At a glance

Occurrence records1 348

Data sources7

Biological traits0

DNA specimens44

eDNA detections35

Sources7 archives

Databases and archives Anthrenus lepidus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 348 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 348 records

Environmental DNA1 datasets · 1 countries35 detections

DNA & barcodingBOLD44 specimens

01Narrative

Anthrenus lepidus is a species of carpet beetle in the family Dermestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthrenus lepidus has left across the world's sequence archives.

At a glance

DNA specimens44

BINs3

Marker genes1

eDNA detections35

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

148Amostly conserved

220Tmostly conserved

250Cmostly conserved

361Cmostly conserved

370Cmostly conserved

505Tmostly conserved

535Cmostly conserved

557Tmostly conserved

616Tmostly conserved

AACACTATACTTCATTTTTGGAGCCTGAGCAGGAATAACTGGAACTTCCTTAAGAATATTAATCCGGACAGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.48%

Haplotypes14

BINs3

Most divergent pair1.7%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthrenus scrophulariaesame genus11.6%Anthrenus festivussame genus11.6%Anthrenus angustefasciatussame genus13.6%Anthrenus pimpinellaesame genus14.0%Anthrenus flavipessame genus15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 348 records

Wild obs. + sensor879

Museum / vouchered469

Range

Area of Occupancy AOO3 168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 515≤1 km 109≤10 km 29>10 km 39

692 georeferenced · 187 without coordinates

Open the mapobservation + sensor879

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 1≤10 km 5>10 km 4

10 georeferenced · 459 without coordinates

Open the institutions mapphysical evidence469

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	259
Chicago, US	194
Champaign, US	4
Universidad Católica de Manizaleslocation not on record	3
Washington, US	3
San Francisco, US	2
San Diego, US	1
Cambridge, US	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
ASUlocation not on record	1

10 institutions · 469 of 469 vouchered records shown

09Environmental DNA35 detections

Where the DNA of Anthrenus lepidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 15.6–21.1

Seasonal swing summer↔winter18.6 °C

Max temp (day)24.8 °C 21.9–29.5

Min temp (night)11.0 °C 9.20–14.3

Precipitation14.9 mm/mo 1.80–56.0

Air humidity50.8 % 45.6–60.3

Moisture balance-144 mm/mo -164–-70.9

Vapour deficit913 Pa 819–1,359

Wind speed2.80 m/s 1.60–3.80

Cloud cover31.1 % 18.9–53.5

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthrenus lepidus

At a glance

Sources7 archives

At a glance

Record type1 348 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 348 records