Anthrenus festivus

Erichson, 1846 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Dermestidae/Anthrenus

At a glance

Occurrence records526

Data sources7

Biological traits0

DNA specimens6

eDNA detections4

Sources7 archives

Databases and archives Anthrenus festivus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility526 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF526 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD6 specimens

01Narrative

Anthrenus festivus is a species of carpet beetle in the family Dermestidae. It is found in western Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthrenus festivus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACACTATACTTTATCTTCGGCGCCTGAGCAGGAATAACAGGAACCTCTCTAAGAATACTAATCCGAACAGAATTAGGAAACCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthrenus lepidussame genus11.6%Anthrenus scrophulariaesame genus12.2%Megatoma perversasame family14.1%Anthrenus pimpinellaesame genus14.3%Anthrenus isabellinussame genus14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type526 records

Wild obs. + sensor485

Museum / vouchered28

Other13

Origin

Native13

Range

Area of Occupancy AOO1 316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 134≤1 km 76≤10 km 34>10 km 10

254 georeferenced · 231 without coordinates

Open the mapobservation + sensor485

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 4

4 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	18
Natural History Museum Rotterdamlocation not on record	3
Office National des Forets, Laboratoire National d'Entomologie Forestierelocation not on record	2
Provincia di Livornolocation not on record	1

4 institutions · 24 of 28 vouchered records shown · 4 without an institution code

09Environmental DNA4 detections

Where the DNA of Anthrenus festivus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 14.4–14.4

Seasonal swing summer↔winter18.3 °C

Max temp (day)18.7 °C

Min temp (night)9.10 °C

Precipitation53.9 mm/mo

Air humidity57.6 %

Moisture balance-50.6 mm/mo

Vapour deficit769 Pa

Wind speed4.00 m/s

Cloud cover46.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)