Anthrenus isabellinus

Animalia/Arthropoda/Insecta/Coleoptera/Dermestidae/Anthrenus

At a glance

Occurrence records1 135

Data sources3

Biological traits0

DNA specimens7

eDNA detections0

Sources3 archives

Databases and archives Anthrenus isabellinus's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 135 records↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF1 135 records

DNA & barcodingBOLD7 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthrenus isabellinus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P575 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.17%

Where individuals differ — all 1 variable positions, in barcode order

413Cvariable

TAAGAATCCTAATCCGAACAGAACTAGGAAACCCAGGATCCATAATTGGAGACGACCAAACGTTTAATGTAATCGTAACAGCTCACGCAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthrenus angustefasciatussame genus12.5%Anthrenus festivussame genus14.4%Anthrenus pimpinellaesame genus14.8%Anthrenus coloratussame genus15.7%Anthrenus scrophulariaesame genus15.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type1 135 records

Wild obs. + sensor1 135

Range

Area of Occupancy AOO2 664 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 482≤1 km 139≤10 km 93>10 km 84

798 georeferenced · 337 without coordinates

Open the mapobservation + sensor1 135

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

At a glance

Sources3 archives

At a glance

Record type1 135 records

Range

Wildobservation + sensor

Wildobservation + sensor

Record type1 135 records