Anthrenus coloratus

Reitter, 1881 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Dermestidae/Anthrenus

At a glance

Occurrence records670

Data sources6

Biological traits0

DNA specimens4

eDNA detections0

Sources6 archives

Databases and archives Anthrenus coloratus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility670 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF670 records

DNA & barcodingBOLD4 specimens

01Narrative

Anthrenus coloratus is a species in the family Dermestidae ("carpet beetles"), in the order Coleoptera ("beetles"). The species is known generally as the "Asian carpet beetle". It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthrenus coloratus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.3%

Haplotypes2

BIN1

Most divergent pair1.5%

Where individuals differ — all 15 variable positions, in barcode order

67Amostly conserved

151Cmostly conserved

178Gmostly conserved

217Avariable

275Tmostly conserved

364Cmostly conserved

383Cvariable

404Cvariable

529Cmostly conserved

535Tvariable

610Cmostly conserved

625Amostly conserved

637Tmostly conserved

643Cvariable

650Tmostly conserved

ACTATACTTTATCTTTGGAGCATGAGCCGGAATAGTGGGAACCTCATTAAGAATCCTTATTCGAACAGAACTGGGAAACCCAGGATCTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthrenus angustefasciatussame genus14.5%Anthrenus pimpinellaesame genus15.8%Trogoderma glabrumsame family16.2%Anthrenus lepidussame genus16.4%Megatoma undatasame family16.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type670 records

Wild obs. + sensor594

Museum / vouchered72

Fossil2

Other2

Origin

Native2

Range

Area of Occupancy AOO1 924 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 278≤1 km 52≤10 km 23>10 km 119

472 georeferenced · 122 without coordinates

Open the mapobservation + sensor594

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 50>10 km 6

56 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence72

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	37
Lexington, US	12
Chicago, US	9
Wuzhou, CN	8
East Lansing, US	5
Santa Barbara Museum of Natural Historylocation not on record	1

6 institutions · 72 of 72 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)