Anthrenus angustefasciatus

Ganglbauer, 1904 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Dermestidae/Anthrenus

At a glance

Occurrence records1 623

Data sources7

Biological traits0

DNA specimens6

eDNA detections6

Sources7 archives

Databases and archives Anthrenus angustefasciatus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 623 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 623 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Dorsalansicht Ventralansicht Anthrenus angustefasciatus ist ein Käfer aus der Familie der Speckkäfer. Der Artname kommt aus dem Lateinischen und setzt sich aus den Begriffen anguste für „eingeschnürt“ und fasciatus für „bändrig“ zusammen und bezieht sich auf das entweder eingeschnürte oder unterbrochene Querband nahe der Flügeldeckenbasis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthrenus angustefasciatus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.08%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

428Cmostly conserved

CGTTATACTTCATCTTTGGTGCCTGAGCAGGAATAATTGGAACTTCATTAAGAATCTTAATTCGAACAGAACTGGGAAATCCAGGATCCC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthrenus isabellinussame genus12.5%Anthrenus dorsatussame genus12.9%Anthrenus lepidussame genus13.6%Anthrenus scrophulariaesame genus13.7%Phradonoma nobilesame family13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 623 records

Wild obs. + sensor1 479

Museum / vouchered137

Other7

Origin

Native84

Range

Area of Occupancy AOO3 756 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 719≤1 km 255≤10 km 126>10 km 52

1 152 georeferenced · 327 without coordinates

Open the mapobservation + sensor1 479

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy2% within 1 km

≤100 m 1≤1 km 1≤10 km 123

125 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence137

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	18
Geneva, CH	12
Muzeum Górnośląskie w Bytomiulocation not on record	5
Paris, FR	4
Naturmuseum Solothurnlocation not on record	2
Office National des Forets, Laboratoire National d'Entomologie Forestierelocation not on record	1

6 institutions · 42 of 137 vouchered records shown · 95 without an institution code

09Environmental DNA6 detections

Where the DNA of Anthrenus angustefasciatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 17.7–20.4

Seasonal swing summer↔winter15.1 °C

Max temp (day)20.5 °C 20.5–23.6

Min temp (night)14.9 °C 13.5–16.5

Precipitation47.4 mm/mo 38.5–126

Air humidity58.3 % 57.3–59.7

Moisture balance-87.4 mm/mo -127–-5.10

Vapour deficit860 Pa 818–1,034

Wind speed2.00 m/s 2.00–3.70

Cloud cover42.5 % 38.3–42.5

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthrenus angustefasciatus

At a glance

Sources7 archives

At a glance

Record type1 623 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 6 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 623 records