Anthrenus pimpinellae

Fabricius, 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Dermestidae/Anthrenus

At a glance

Occurrence records1 628

Data sources7

Biological traits0

DNA specimens24

eDNA detections21

Sources7 archives

Databases and archives Anthrenus pimpinellae's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 628 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 628 records

Environmental DNA1 datasets · 4 countries21 detections

DNA & barcodingBOLD24 specimens

01Narrative

Anthrenus pimpinellae is a species of beetle found natively in Europe, northern Africa, Asia and portions of the Oriental region; it has also been introduced to parts of North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthrenus pimpinellae has left across the world's sequence archives.

At a glance

DNA specimens24

BINs5

Marker genes1

eDNA detections21

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Where individuals differ — all 111 variable positions, in barcode order

1Amostly conserved

4Amostly conserved

5Cmostly conserved

7Tmostly conserved

10Cmostly conserved

19Tvariable

22Amostly conserved

28Amostly conserved

38Gmostly conserved

46Tmostly conserved

49Amostly conserved

50Cmostly conserved

58Amostly conserved

61Amostly conserved

64Tmostly conserved

74Tmostly conserved

82Cmostly conserved

91Amostly conserved

92Cmostly conserved

94Amostly conserved

97Tmostly conserved

112Amostly conserved

115Tmostly conserved

118Cmostly conserved

133Cmostly conserved

136Tmostly conserved

143Amostly conserved

145Cmostly conserved

154Tmostly conserved

172Cmostly conserved

178Tmostly conserved

187Tmostly conserved

190Tmostly conserved

193Cmostly conserved

197Cmostly conserved

202Tmostly conserved

205Cmostly conserved

211Gmostly conserved

220Cmostly conserved

223Amostly conserved

226Cmostly conserved

229Gmostly conserved

266Tmostly conserved

271Tmostly conserved

274Amostly conserved

277Tmostly conserved

278Cmostly conserved

283Cmostly conserved

284Cmostly conserved

289Cmostly conserved

290Cmostly conserved

292Amostly conserved

293Cmostly conserved

313Gmostly conserved

316Cmostly conserved

319Amostly conserved

334Amostly conserved

343Cmostly conserved

346Tmostly conserved

364Tmostly conserved

370Tmostly conserved

376Amostly conserved

379Amostly conserved

385Cmostly conserved

394Tmostly conserved

397Tmostly conserved

406Tmostly conserved

409Amostly conserved

412Amostly conserved

421Amostly conserved

430Gmostly conserved

433Tmostly conserved

439Cmostly conserved

448Tmostly conserved

463Tmostly conserved

473Gmostly conserved

474Cmostly conserved

484Amostly conserved

496Amostly conserved

499Tmostly conserved

511Amostly conserved

523Tmostly conserved

526Tmostly conserved

529Gmostly conserved

530Amostly conserved

538Tmostly conserved

541Tmostly conserved

542Cmostly conserved

544Tmostly conserved

547Tvariable

550Amostly conserved

559Amostly conserved

568Cmostly conserved

571Tmostly conserved

574Amostly conserved

581Tmostly conserved

586Tmostly conserved

592Tmostly conserved

596Cmostly conserved

598Cmostly conserved

601Cmostly conserved

604Amostly conserved

610Tmostly conserved

616Tmostly conserved

619Amostly conserved

622Tmostly conserved

631Amostly conserved

634Tmostly conserved

640Cvariable

646Tvariable

658Cmostly conserved

AACACTTTACTTCATCTTTGGAGCCTGAGCAGGAATAGTTGGAACTTCACTAAGAATACTAATTCGAACAGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.5%

Haplotypes4

BINs5

Most divergent pair14.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthrenus scrophulariaesame genus13.5%Anthrenus lepidussame genus14.0%Anthrenus festivussame genus14.3%Anthrenus angustefasciatussame genus14.8%Megatoma perversasame family15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 628 records

Wild obs. + sensor1 354

Museum / vouchered217

Other57

Origin

Native4

Introduced1

Range

Area of Occupancy AOO4 088 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 388≤1 km 379≤10 km 280>10 km 34

1 081 georeferenced · 273 without coordinates

Open the mapobservation + sensor1 354

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 7≤1 km 39≤10 km 114>10 km 2

162 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence217

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum Rotterdamlocation not on record	39
Provincia di Livornolocation not on record	20
Muzeum Górnośląskie w Bytomiulocation not on record	17
Philadelphia, US	12
Tilburg, NL	10
NMOKlocation not on record	9
SLU Artdatabankenlocation not on record	8
Ugentlocation not on record	7
Uniwersytet Wrocławskilocation not on record	6
IMEDEAlocation not on record	5
ZSMlocation not on record	5
Australian National Fish Collectionlocation not on record	5
MZLUlocation not on record	4
IFR-DNFlocation not on record	4
Helsinki, FI	3
Salzburg, AT	3
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
Winterthur, CH	2
Ghent, BE	1
Sydney, AU	1
Bavarian State Collection of Zoologylocation not on record	1
Albuquerque, US	1
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	1
Philadelphia, US	1

24 institutions · 167 of 217 vouchered records shown · 50 without an institution code

09Environmental DNA21 detections

Where the DNA of Anthrenus pimpinellae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map4 countries0

Agricultural fieldWaldrandim Haus

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 12.7–19.6

Seasonal swing summer↔winter18.5 °C

Max temp (day)20.6 °C 16.8–23.2

Min temp (night)11.7 °C 7.80–14.2

Precipitation54.5 mm/mo 52.1–83.6

Air humidity58.5 % 55.8–59.6

Moisture balance-57.7 mm/mo -93.1–-31.3

Vapour deficit773 Pa 598–1,007

Wind speed3.10 m/s 2.80–4.00

Cloud cover39.1 % 33.6–40.0

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthrenus pimpinellae

At a glance

Sources7 archives

At a glance

Record type1 628 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 628 records