Anthrenus flavipes

Leconte, 1856 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Dermestidae/Anthrenus

At a glance

Occurrence records193

Data sources10

Biological traits0

DNA specimens6

eDNA detections8

Sources10 archives

Databases and archives Anthrenus flavipes's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility193 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF193 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD6 specimens

Genome at a glanceGoaT · TreeOfSex2n = 18

01Narrative

Anthrenus flavipes is a species of beetle in the family Dermestidae known by the common name furniture carpet beetle. It has a cosmopolitan distribution, occurring throughout the world, being most active in warmer climates.Gahlhoff, J. E. Furniture carpet beetle (Anthrenus flavipes). Publication Number EENY-19. University of Florida IFAS. 1997, revised 2010. It is a pest that damages household materials such as textiles. Imago

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthrenus flavipes has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACTCTATACTTTCTATTTGGAGCCTGAGCAGGAATAATCGGAACATCCCTTAGTATTTTAATCCGAACAGAATTAGGAAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthrenus festivussame genus14.7%Anthrenus lepidussame genus15.3%Anthrenus angustefasciatussame genus15.4%Anthrenus pimpinellaesame genus15.8%Megatoma perversasame family16.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Anthrenus flavipes carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidy2× diploid · measured

Chromosome records18–182n range18median18mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 186×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Smith SG, Virkki N (1978) Animal Cytogenetics Vol. 3 Insecta 5 Coleoptera. Berlin: Gebruder Borntraeger. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type193 records

Wild obs. + sensor57

Museum / vouchered134

Other2

Range

Area of Occupancy AOO240 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 38≤1 km 3≤10 km 5>10 km 3

49 georeferenced · 8 without coordinates

Open the mapobservation + sensor57

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤1 km 13≤10 km 20>10 km 54

87 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence134

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Lexington, US	64
Chicago, US	28
Vitoria, ES	11
DPIlocation not on record	9
Champaign, US	4
Australian National Fish Collectionlocation not on record	3
NHMOlocation not on record	2
Wuzhou, CN	1
Cambridge, US	1
Museums Victorialocation not on record	1
Auckland, NZ	1
QVMAGlocation not on record	1
Sydney, AU	1
Natural History Museum Rotterdamlocation not on record	1

14 institutions · 128 of 134 vouchered records shown · 6 without an institution code

09Environmental DNA8 detections

Where the DNA of Anthrenus flavipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 4.60–15.6

Seasonal swing summer↔winter15.3 °C

Max temp (day)18.1 °C 8.20–18.1

Min temp (night)12.4 °C 1.00–12.4

Precipitation45.3 mm/mo 45.3–46.6

Air humidity58.7 % 58.7–62.0

Moisture balance-78.8 mm/mo -78.8–3.80

Vapour deficit778 Pa 323–778

Wind speed6.00 m/s 2.90–6.00

Cloud cover45.2 % 45.2–47.0

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)