Anthophora affabilis

Cresson, 1879 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Anthophora

At a glance

Occurrence records1 210

Data sources5

Biological traits1

DNA specimens9

eDNA detections0

Sources5 archives

Databases and archives Anthophora affabilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 210 records↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 210 records

DNA & barcodingBOLD9 specimens

01Narrative

Anthophora affabilis est une espèce d'insectes de l'ordre des hyménoptères, de la famille des Apidae. C'est une abeille solitaire.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)4.17 mm

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophora affabilis has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P430 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.37%

Haplotypes1

BIN1

Where individuals differ — all 6 variable positions, in barcode order

277Tvariable

298Amostly conserved

307Gmostly conserved

322Amostly conserved

370Tmostly conserved

388Tmostly conserved

AGCATTTCCTCGTATAAATAATATTAGGTTTTGATTATTACCTCCTTCATTAATTTTATTACTTTTGAGAAATTTATTTCAAGTTAGTCC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora porteraesame genus6.7%Anthophora aestivalissame genus7.9%Anthophora pacificasame genus8.3%Anthophora hispanicasame genus8.4%Anthophora senescenssame genus8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 210 records

Wild obs. + sensor9

Museum / vouchered1 201

Range

Area of Occupancy AOO1 036 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 3>10 km 1

4 georeferenced · 5 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 172≤1 km 11≤10 km 5>10 km 2

190 georeferenced · 1 011 without coordinates

Open the institutions mapphysical evidence1 201

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	532
Universidad Católica de Manizaleslocation not on record	186
Awka, NG	148
US	97
Albuquerque, US	84
Wuzhou, CN	83
WIlocation not on record	24
	15
University of Alabamalocation not on record	10
Lubbock, US	7
WSUClocation not on record	5
Chicago, US	2
Weber State University, Bird and Mammal Collectionlocation not on record	2
Oregon State Arthropod Collectionlocation not on record	2
Cambridge, US	1
München, DE	1
Colorado State Universitylocation not on record	1
Champaign, US	1

18 institutions · 1 201 of 1 201 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthophora affabilis

At a glance

Sources5 archives

Size & morphology1

At a glance

Record type1 210 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 18 geolocated

Record type1 210 records