Anthophora aestivalis

(Panzer, 1801) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Anthophora

At a glance

Occurrence records3 424

Data sources7

Biological traits2

DNA specimens38

eDNA detections32

Sources7 archives

Databases and archives Anthophora aestivalis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 424 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 424 records

Environmental DNA1 datasets · 7 countries32 detections

DNA & barcodingBOLD38 specimens

01Narrative

Anthophora aestivalis ist eine Biene aus der Familie der Apidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology2

Tongue length3 mm

Tongue width0.6 mm

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophora aestivalis has left across the world's sequence archives.

At a glance

DNA specimens38

BINs2

Marker genes1

eDNA detections32

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

14Gmostly conserved

46Amostly conserved

61Tmostly conserved

79Tmostly conserved

85Tmostly conserved

121Gmostly conserved

175Gmostly conserved

208Gmostly conserved

214Gmostly conserved

241Amostly conserved

274Tmostly conserved

310Amostly conserved

319Amostly conserved

373Amostly conserved

382Tmostly conserved

433Gmostly conserved

458Gmostly conserved

514Amostly conserved

607Amostly conserved

631Gmostly conserved

AATGATTTATTTTGTTTTTGCATTATGATCTGGAATAATTGGTACATCTATAAGTATAATTATTCGTATAGAATTAAGTACTCCTGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.58%

Haplotypes3

BINs2

Most divergent pair3.0%

EuropeAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora retusasame genus4.0%Anthophora leucophaeasame genus5.7%Anthophora sicheliisame genus6.0%Anthophora atricepssame genus6.4%Anthophora atroalbasame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 424 records

Wild obs. + sensor1 212

Museum / vouchered2 145

Other67

Origin

Native978

Range

Area of Occupancy AOO4 076 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 358≤1 km 166≤10 km 555>10 km 12

1 091 georeferenced · 121 without coordinates

Open the mapobservation + sensor1 212

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤100 m 31≤1 km 110≤10 km 1 783>10 km 38

1 962 georeferenced · 183 without coordinates

Open the institutions mapphysical evidence2 145

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bern, CH	283
Zürich, CH	271
Musee d'Histoire Naturallelocation not on record	245
Provincia di Livornolocation not on record	108
	84
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	75
Paro, BT	72
Geneva, CH	65
PRAZlocation not on record	41
ULglocation not on record	39
Philadelphia, US	20
Wuzhou, CN	19
Museum zu Allerheiligen Schaffhausenlocation not on record	17
Sion, CH	17
Bonn, DE	17
ZSMlocation not on record	15
NMOKlocation not on record	15
IENElocation not on record	14
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	12
Dhaka, BD	10
PRUNlocation not on record	9
Tilburg, NL	5
Universität Zürich, Naturhistorisches Museumlocation not on record	4
European Distributed Institute of Taxonomy (EDIT)location not on record	4
Muzeum Górnośląskie w Bytomiulocation not on record	3
Research Collection of Christophe Prazlocation not on record	3
Fribourg, CH	2
Tartu, EE	2
LDSVlocation not on record	2
EIBElocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
Uniwersytet Łódzkilocation not on record	2
UMUlocation not on record	2
Mons, BE	1
MZLUlocation not on record	1

35 institutions · 1 483 of 2 145 vouchered records shown · 662 without an institution code

09Environmental DNA32 detections

Where the DNA of Anthophora aestivalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map7 countries0

Bord de route

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 4.60–19.1

Seasonal swing summer↔winter18.2 °C

Max temp (day)18.1 °C 8.80–23.2

Min temp (night)8.80 °C -1.60–13.5

Precipitation83.4 mm/mo 45.6–118

Air humidity58.6 % 55.2–61.5

Moisture balance-26.8 mm/mo -99.1–20.5

Vapour deficit673 Pa 326–903

Wind speed3.20 m/s 2.20–5.20

Cloud cover37.3 % 32.6–41.2

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthophora aestivalis

At a glance

Sources7 archives

Size & morphology2

At a glance

Record type3 424 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 424 records