Anthophora retusa

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Anthophora

At a glance

Occurrence records5 045

Data sources9

Biological traits0

DNA specimens26

eDNA detections17

Sources9 archives

Databases and archives Anthophora retusa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 045 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 045 records

Environmental DNA3 datasets · 8 countries17 detections

DNA & barcodingBOLD26 specimens

Genome at a glanceGoaT · NCBI≈445 Mbp

01Narrative

Anthophora retusa, the potter flower bee, is a species of solitary digger bee.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophora retusa has left across the world's sequence archives.

At a glance

DNA specimens26

BINs3

Marker genes1

eDNA detections17

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 84 variable positions, in barcode order

11Gmostly conserved

13Tmostly conserved

19Amostly conserved

25Gmostly conserved

26Tmostly conserved

31Gmostly conserved

43Tmostly conserved

52Tmostly conserved

76Tmostly conserved

78Cmostly conserved

82Gmostly conserved

85Gmostly conserved

86Gmostly conserved

87Cmostly conserved

88Tmostly conserved

91Gmostly conserved

96Gmostly conserved

97Amostly conserved

107Amostly conserved

124Tmostly conserved

127Tmostly conserved

145Amostly conserved

157Amostly conserved

178Amostly conserved

181Tmostly conserved

187Amostly conserved

214Gmostly conserved

215Gmostly conserved

217Cvariable

220Tmostly conserved

238Amostly conserved

253Avariable

271Tmostly conserved

274Amostly conserved

279Cmostly conserved

286Gmostly conserved

292Gmostly conserved

295Amostly conserved

316Amostly conserved

319Amostly conserved

325Gmostly conserved

331Tmostly conserved

354Amostly conserved

367Tmostly conserved

370Amostly conserved

373Tmostly conserved

376Amostly conserved

379Tmostly conserved

385Tmostly conserved

388Tvariable

409Amostly conserved

412Amostly conserved

413Gmostly conserved

418Tmostly conserved

421Amostly conserved

431Gmostly conserved

433Tmostly conserved

448Tmostly conserved

455Amostly conserved

460Gmostly conserved

471Tmostly conserved

472Amostly conserved

475Amostly conserved

483Amostly conserved

491Amostly conserved

496Amostly conserved

505Tmostly conserved

511Tmostly conserved

523Avariable

529Tmostly conserved

541Amostly conserved

547Amostly conserved

550Gmostly conserved

553Tmostly conserved

559Tmostly conserved

562Gmostly conserved

565Amostly conserved

577Gmostly conserved

589Tmostly conserved

604Tmostly conserved

622Tmostly conserved

625Amostly conserved

628Gmostly conserved

634Tmostly conserved

GATTTATTTTGTTTTTGCATTATGGTCTGGGATAATTGGTACTTCTATAAGTATAATTATTCGTATAGAATTAAGTACTCCGGGGGCTTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes4

BINs2

Most divergent pair0.92%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora aestivalissame genus4.0%Anthophora leucophaeasame genus5.8%Anthophora atroalbasame genus7.0%Anthophora sicheliisame genus7.2%Anthophora atricepssame genus8.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anthophora retusa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈445 130 585 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anthophora retusa0.45 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type5 045 records

Wild obs. + sensor3 768

Museum / vouchered1 157

Other120

Origin

Native175

Range

Area of Occupancy AOO5 696 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 2 601≤1 km 427≤10 km 626>10 km 7

3 661 georeferenced · 107 without coordinates

Open the mapobservation + sensor3 768

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 68≤1 km 327≤10 km 663>10 km 22

1 080 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence1 157

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	332
ULglocation not on record	160
Zürich, CH	132
Coimbra, PT	81
MZLUlocation not on record	70
Wuzhou, CN	60
Paro, BT	58
Mons, BE	33
Natural History Museum Rotterdamlocation not on record	22
Bern, CH	14
Muzeum Górnośląskie w Bytomiulocation not on record	13
Musee d'Histoire Naturallelocation not on record	13
Bonn, DE	12
ZSMlocation not on record	11
NMOKlocation not on record	9
Cambridge, US	6
Ghent, BE	5
Beltsville, US	4
Gothenburg, SE	4
NCMGlocation not on record	4
Philadelphia, US	3
Museo Nacional de Ciencias Naturaleslocation not on record	3
Research Collection of Christophe Prazlocation not on record	3
Bavarian State Collection of Zoologylocation not on record	3
Stockholm, SE	3
Natuurpuntlocation not on record	3
Provincia di Livornolocation not on record	3
CBDClocation not on record	2
Museum zu Allerheiligen Schaffhausenlocation not on record	2
PRUNlocation not on record	1
KZMlocation not on record	1
Tilburg, NL	1
Uniwersytet Łódzkilocation not on record	1
Ugentlocation not on record	1
IMEDEAlocation not on record	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1

36 institutions · 1 075 of 1 157 vouchered records shown · 82 without an institution code

09Environmental DNA17 detections

Where the DNA of Anthophora retusa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys3

Countries8

Verifiable raw sequence linked4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map8 countries0

kiwifruit orchard

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.4 °C 5.50–16.3

Seasonal swing summer↔winter18.4 °C

Max temp (day)16.7 °C 9.50–20.5

Min temp (night)6.70 °C 1.80–11.0

Precipitation57.6 mm/mo 28.4–82.0

Air humidity59.0 % 51.0–60.7

Moisture balance-38.5 mm/mo -107–-14.4

Vapour deficit615 Pa 361–780

Wind speed3.30 m/s 2.20–4.30

Cloud cover38.4 % 31.9–44.5

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthophora retusa

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 045 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 045 records