Anthophora porterae

Cockerell, 1900 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Anthophora

At a glance

Occurrence records857

Data sources6

Biological traits1

DNA specimens17

eDNA detections28

Sources6 archives

Databases and archives Anthophora porterae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility857 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF857 records

Environmental DNA1 datasets · 2 countries28 detections

DNA & barcodingBOLD17 specimens

01Narrative

Anthophora porterae is een vliesvleugelig insect uit de familie bijen en hommels (Apidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1900 door Cockerell.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)4.3 mm

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophora porterae has left across the world's sequence archives.

At a glance

DNA specimens17

BINs3

Marker genes1

eDNA detections28

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

81Cmostly conserved

82Gmostly conserved

88Avariable

121Amostly conserved

181Gmostly conserved

220Tmostly conserved

271Tvariable

280Gvariable

316Avariable

328Avariable

343Avariable

370Avariable

373Amostly conserved

379Avariable

382Tvariable

412Tvariable

418Avariable

421Avariable

433Avariable

439Avariable

454Avariable

458Avariable

460Avariable

497Tvariable

517Avariable

529Tvariable

535Gvariable

541Avariable

544Gvariable

562Tvariable

565Tvariable

568Avariable

628Avariable

631Gvariable

637Tmostly conserved

GATAATTTATTTTATTTTTGCTTTATGGTCAGGGATAGTAGGGACTTCAATAAGTATACTTATTCGTATAGAATTGAGAGCGCCTGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes4

BINs2

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora vannigerasame genus8.2%Anthophora affinissame genus8.7%Anthophora crinipessame genus8.8%Anthophora senescenssame genus9.4%Anthophora mucidasame genus9.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type857 records

Wild obs. + sensor33

Museum / vouchered823

Other1

Range

Area of Occupancy AOO1 024 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 22≤1 km 1≤10 km 2>10 km 3

28 georeferenced · 5 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 130≤1 km 8≤10 km 26>10 km 25

189 georeferenced · 634 without coordinates

Open the institutions mapphysical evidence823

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	414
Colorado State Universitylocation not on record	130
Awka, NG	95
Albuquerque, US	70
Natural History Museum of Utahlocation not on record	19
Oregon State Arthropod Collectionlocation not on record	18
WSUClocation not on record	15
Wuzhou, CN	12
	9
US	7
Cambridge, US	5
New Haven, US	5
Champaign, US	4
Weber State University, Bird and Mammal Collectionlocation not on record	3
University of Alabamalocation not on record	3
WIlocation not on record	2
Alberta Environment and Parkslocation not on record	2
Washington, US	2
ASUlocation not on record	2
EL PASO, US	1
OSUClocation not on record	1
Mexico City, MX	1
Provo, US	1
San Francisco, US	1
US	1

25 institutions · 823 of 823 vouchered records shown

09Environmental DNA28 detections

Where the DNA of Anthophora porterae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.1 °C 5.20–14.8

Seasonal swing summer↔winter24.6 °C

Max temp (day)14.6 °C 8.90–20.8

Min temp (night)5.20 °C -0.2–8.00

Precipitation40.8 mm/mo 24.6–70.5

Air humidity53.4 % 49.9–60.1

Moisture balance-67.9 mm/mo -97.8–-16.4

Vapour deficit572 Pa 397–847

Wind speed2.90 m/s 2.10–4.10

Cloud cover40.7 % 38.2–45.3

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)