Anthophora crinipes

Smith, 1854 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Anthophora

At a glance

Occurrence records1 503

Data sources7

Biological traits1

DNA specimens18

eDNA detections19

Sources7 archives

Databases and archives Anthophora crinipes's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 503 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 503 records

Environmental DNA1 datasets · 9 countries19 detections

DNA & barcodingBOLD18 specimens

01Narrative

Anthophora crinipes ist eine Biene aus der Familie der Apidae. Die Weibchen können mit Anthophora quadrimaculata und Anthophora crassipes verwechselt werden, Männchen sehen Anthophora plumipes ähnlich.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)3.72 mm

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophora crinipes has left across the world's sequence archives.

At a glance

DNA specimens18

BINs2

Marker genes1

eDNA detections19

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 39 variable positions, in barcode order

43Amostly conserved

58Gmostly conserved

70Amostly conserved

76Amostly conserved

79Tmostly conserved

130Amostly conserved

133Tmostly conserved

135Amostly conserved

136Tvariable

181Amostly conserved

190Tmostly conserved

196Amostly conserved

205Amostly conserved

208Gmostly conserved

211Amostly conserved

214Amostly conserved

223Amostly conserved

271Tmostly conserved

295Amostly conserved

310Amostly conserved

316Gmostly conserved

322Amostly conserved

337Tmostly conserved

347Tmostly conserved

370Amostly conserved

382Tmostly conserved

403Amostly conserved

409Amostly conserved

416Gvariable

421Tvariable

433Amostly conserved

434Tvariable

451Cvariable

467Cmostly conserved

494Amostly conserved

511Amostly conserved

556Tmostly conserved

577Amostly conserved

622Amostly conserved

AATGATTTATTTTATATTTGCTTTATGATCAGGAATAATTGGAACTTCAATAAGAATGATTATTCGAATAGAATTAAGTACTCCAGGCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes4

BINs2

Most divergent pair5.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora senescenssame genus6.4%Anthophora vannigerasame genus7.3%Anthophora fulvitarsissame genus7.4%Anthophora disparsame genus7.5%Anthophora mucidasame genus7.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 503 records

Wild obs. + sensor438

Museum / vouchered1 019

Other46

Origin

Native294

Range

Area of Occupancy AOO1 984 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 157≤1 km 69≤10 km 112>10 km 17

355 georeferenced · 83 without coordinates

Open the mapobservation + sensor438

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 85≤1 km 280≤10 km 554>10 km 70

989 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence1 019

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	240
Provincia di Livornolocation not on record	222
Paro, BT	61
UMONSlocation not on record	54
Musee d'Histoire Naturallelocation not on record	42
Coimbra, PT	39
Bern, CH	32
Geneva, CH	18
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	15
Sion, CH	14
Philadelphia, US	12
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	12
PRAZlocation not on record	11
	11
NMOKlocation not on record	10
Wuzhou, CN	8
IENElocation not on record	6
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	4
Royal British Columbia Museumlocation not on record	3
PRUNlocation not on record	2
Fribourg, CH	2
Archäologie und Museum Baselland - Museum.BLlocation not on record	2
Bonn, DE	1

23 institutions · 821 of 1 019 vouchered records shown · 198 without an institution code

09Environmental DNA19 detections

Where the DNA of Anthophora crinipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 11.1–17.3

Seasonal swing summer↔winter19.1 °C

Max temp (day)18.1 °C 14.9–20.6

Min temp (night)8.70 °C 5.60–14.1

Precipitation64.1 mm/mo 42.0–124

Air humidity59.4 % 55.2–61.7

Moisture balance-48.1 mm/mo -77.3–24.5

Vapour deficit713 Pa 541–828

Wind speed3.00 m/s 2.10–4.60

Cloud cover38.6 % 35.8–41.9

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthophora crinipes

At a glance

Sources7 archives

Size & morphology1

At a glance

Record type1 503 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 503 records