Anthophora senescens

Lepeletier, 1841 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Anthophora

At a glance

Occurrence records49

Data sources5

Biological traits0

DNA specimens7

eDNA detections0

Sources5 archives

Databases and archives Anthophora senescens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility49 records↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF49 records

DNA & barcodingBOLD7 specimens

01Narrative

Anthophora senescens is een vliesvleugelig insect uit de familie bijen en hommels (Apidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1841 door Lepeletier.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophora senescens has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P682 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.31%

Haplotypes2

BIN1

Most divergent pair0.59%

Where individuals differ — all 4 variable positions, in barcode order

271Avariable

331Gvariable

433Gvariable

436Avariable

GATAATTTATTTTGTATTTGCTTTATGATCAGGAATAATTGGAACTTCAATGAGGATAATTATTCGTATAGAATTAAGAACGCCAGGAAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora crinipessame genus6.4%Anthophora disparsame genus7.0%Anthophora fulvitarsissame genus7.8%Anthophora hispanicasame genus8.3%Anthophora vannigerasame genus8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type49 records

Wild obs. + sensor3

Museum / vouchered28

Other18

Origin

Native9

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 2≤1 km 11≤10 km 3>10 km 5

21 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Coimbra, PT	9
Zürich, CH	6
	6
Wuzhou, CN	5
Philadelphia, US	1
Cambridge, US	1

6 institutions · 28 of 28 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)