Anthophora pacifica

Cresson, 1879 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Anthophora

At a glance

Occurrence records1 218

Data sources6

Biological traits1

DNA specimens12

eDNA detections0

Sources6 archives

Databases and archives Anthophora pacifica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 218 records↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 218 records

DNA & barcodingBOLD12 specimens

01Narrative

Anthophora pacifica is a species of anthophorine bee in the family Apidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)4.24 mm

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophora pacifica has left across the world's sequence archives.

At a glance

DNA specimens12

BINs3

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P422 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

20Amostly conserved

29Amostly conserved

35Amostly conserved

38Amostly conserved

80Tmostly conserved

83Tmostly conserved

86Amostly conserved

92Avariable

134Tmostly conserved

137Amostly conserved

143Tmostly conserved

146Gmostly conserved

179Amostly conserved

180Gmostly conserved

182Gmostly conserved

197Tmostly conserved

198Gmostly conserved

203Gmostly conserved

215Amostly conserved

222Tmostly conserved

224Tmostly conserved

230Amostly conserved

250Amostly conserved

261Cmostly conserved

281Tmostly conserved

293Amostly conserved

305Gmostly conserved

317Amostly conserved

329Amostly conserved

332Gmostly conserved

386Amostly conserved

392Gmostly conserved

395Amostly conserved

402Amostly conserved

409Tmostly conserved

CTCGTATAAATAATATTAGATTTTGATTATTACCACCATCATTAATTTTATTACTTTTAAGAAATTTATTTCAAGTTAGTCCTGGAACTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes5

BINs3

Most divergent pair8.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora porteraesame genus6.2%Anthophora mucidasame genus6.9%Anthophora affinissame genus7.4%Anthophora vannigerasame genus7.6%Anthophora affabilissame genus8.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 218 records

Wild obs. + sensor436

Museum / vouchered782

Range

Area of Occupancy AOO1 776 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 162≤1 km 46≤10 km 10>10 km 163

381 georeferenced · 55 without coordinates

Open the mapobservation + sensor436

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 5≤1 km 36≤10 km 25>10 km 4

70 georeferenced · 712 without coordinates

Open the institutions mapphysical evidence782

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	269
Oregon State Arthropod Collectionlocation not on record	254
	90
Wuzhou, CN	75
Santa Cruz, US	28
Natural History Museum of Utahlocation not on record	19
OSUClocation not on record	8
WSUClocation not on record	8
Cambridge, US	6
Weber State University, Bird and Mammal Collectionlocation not on record	6
WIlocation not on record	3
Champaign, US	3
San Diego, US	2
EL PASO, US	1
Roberts Creek, CA	1
US	1
Colorado State Universitylocation not on record	1
Blacksburg, US	1
UNHClocation not on record	1
University of Alabamalocation not on record	1

20 institutions · 778 of 782 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthophora pacifica

At a glance

Sources6 archives

Size & morphology1

At a glance

Record type1 218 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 20 geolocated

Record type1 218 records