Anthocharis julia

Edwards, 1872 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Anthocharis

At a glance

Occurrence records2 691

Data sources7

Biological traits0

DNA specimens57

eDNA detections61

Sources7 archives

Databases and archives Anthocharis julia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 691 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI61 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics57 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 691 records

Environmental DNA1 datasets · 2 countries61 detections

DNA & barcodingBOLD57 specimens

01Narrative

Anthocharis julia, the southern Rocky Mountain orangetip, is a butterfly found in the southern Rocky Mountains on the eastern side of the range. Their caterpillars feed on rock cress (Arabis) species. Adults feed on flower nectar from host plants as well as thistles, fiddleneck, and brodiaeas. Its habitats include foothill canyons and washes, usually in oak woodland, as well as forested riparian areas.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding57 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthocharis julia has left across the world's sequence archives.

At a glance

DNA specimens57

BINs1

Marker genes1

eDNA detections61

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus57 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

44Amostly conserved

283Tmostly conserved

317Gmostly conserved

373Tmostly conserved

415Amostly conserved

424Cmostly conserved

550Amostly conserved

628Amostly conserved

AACTTTATACTTTATTTTTGGAATTTGATCTGGAATAGTAGGTACATCTCTTAGTTTATTAATTCGAACTGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes17

BIN1

Most divergent pair0.91%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthocharis thoosasame genus2.3%Anthocharis sarasame genus2.6%Euchloe fallouisame family7.4%Anthocharis euphenoidessame genus7.4%Anthocharis grunerisame genus7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 691 records

Wild obs. + sensor2 608

Museum / vouchered83

Range

Area of Occupancy AOO5 500 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 1 315≤1 km 570≤10 km 226>10 km 81

2 192 georeferenced · 416 without coordinates

Open the mapobservation + sensor2 608

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 4≤1 km 14≤10 km 6>10 km 7

31 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence83

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WWUlocation not on record	48
East Lansing, US	19
Natural History Museum of Utahlocation not on record	7
Philadelphia, US	4
Albuquerque, US	1
Research Collection of Crispin S. Guppylocation not on record	1
Universidad Católica de Manizaleslocation not on record	1
University Park, US	1

8 institutions · 82 of 83 vouchered records shown · 1 without an institution code

09Environmental DNA61 detections

Where the DNA of Anthocharis julia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found61

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 61 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.20 °C 0.9–10.7

Seasonal swing summer↔winter19.9 °C

Max temp (day)11.8 °C 3.70–17.4

Min temp (night)-1.80 °C -4.40–4.80

Precipitation52.7 mm/mo 24.5–130

Air humidity55.4 % 51.0–60.6

Moisture balance-51.5 mm/mo -86.4–12.9

Vapour deficit440 Pa 265–567

Wind speed4.10 m/s 1.50–5.80

Cloud cover41.6 % 31.3–45.2

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthocharis julia

At a glance

Sources7 archives

At a glance

Record type2 691 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 691 records