Anthocharis gruneri

Herrich-Schäffer, 1851 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Anthocharis

At a glance

Occurrence records426

Data sources7

Biological traits0

DNA specimens39

eDNA detections16

Sources7 archives

Databases and archives Anthocharis gruneri's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility426 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF426 records

Environmental DNA1 datasets · 6 countries16 detections

DNA & barcodingBOLD39 specimens

01Narrative

Anthocharis gruneri (Grüner's orange tip) is a butterfly found mainly in Turkey, Transcaucasian Mountains, Asia Minor and the Armenian highlands.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthocharis gruneri has left across the world's sequence archives.

At a glance

DNA specimens39

BINs2

Marker genes1

eDNA detections16

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

19Tvariable

40Amostly conserved

74Tvariable

82Cmostly conserved

115Cmostly conserved

206Cmostly conserved

208Tmostly conserved

217Amostly conserved

247Tvariable

271Cvariable

367Cvariable

433Amostly conserved

442Cvariable

477Avariable

478Tmostly conserved

511Amostly conserved

553Amostly conserved

634Cmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGTACATCTCTTAGTTTATTAATTCGAACTGAATTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.92%

Haplotypes13

BINs2

Most divergent pair2.6%

EuropeAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthocharis cardaminessame genus2.3%Anthocharis damonesame genus3.0%Celastrina sugitaniisame order3.7%Anthocharis beliasame genus4.1%Anthocharis euphenoidessame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type426 records

Wild obs. + sensor239

Museum / vouchered163

Cultivated / captive21

Other3

Range

Area of Occupancy AOO880 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 87≤1 km 34≤10 km 48>10 km 23

192 georeferenced · 47 without coordinates

Open the mapobservation + sensor239

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤100 m 2≤1 km 7≤10 km 136>10 km 4

149 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence163

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 21 records without

Open the mapnot free-living21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	8
Helsinki, FI	7
Cambridge, US	5
Nijmegen, NL	5
Tartu, EE	4
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	2
NMOKlocation not on record	2
Natural History Museum Rotterdamlocation not on record	1

8 institutions · 34 of 163 vouchered records shown · 129 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA16 detections

Where the DNA of Anthocharis gruneri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 10.4–16.9

Seasonal swing summer↔winter21.1 °C

Max temp (day)16.7 °C 14.9–21.3

Min temp (night)6.10 °C 4.30–10.6

Precipitation49.2 mm/mo 46.6–87.2

Air humidity53.4 % 51.8–58.2

Moisture balance-55.9 mm/mo -101–-34.2

Vapour deficit649 Pa 613–851

Wind speed3.60 m/s 1.20–4.30

Cloud cover34.9 % 33.7–39.3

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)