Anthocharis belia

(Linnaeus, 1767) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Anthocharis

At a glance

Occurrence records458

Data sources8

Biological traits0

DNA specimens22

eDNA detections19

Sources8 archives

Databases and archives Anthocharis belia's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility458 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF458 records

Environmental DNA1 datasets · 4 countries19 detections

DNA & barcodingBOLD22 specimens

01Narrative

Anthocharis belia, the Moroccan orange tip, is a butterfly of the family Pieridae. It is found in northwestern Africa (specifically Morocco, Algeria and Tunisia). The length of the forewings is 18 -.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthocharis belia has left across the world's sequence archives.

At a glance

DNA specimens22

BINs4

Marker genes1

eDNA detections19

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 41 variable positions, in barcode order

4Cmostly conserved

25Tmostly conserved

29Gmostly conserved

34Amostly conserved

40Amostly conserved

49Tvariable

82Cmostly conserved

85Cmostly conserved

91Cmostly conserved

100Amostly conserved

133Tvariable

142Cmostly conserved

181Amostly conserved

202Cmostly conserved

212Cmostly conserved

220Cmostly conserved

235Cvariable

238Cvariable

247Tmostly conserved

274Amostly conserved

358Tmostly conserved

397Tmostly conserved

400Tvariable

412Tmostly conserved

478Cvariable

499Tmostly conserved

508Tmostly conserved

514Amostly conserved

517Amostly conserved

529Cmostly conserved

547Tmostly conserved

550Avariable

562Tmostly conserved

565Amostly conserved

574Cmostly conserved

595Cmostly conserved

601Tmostly conserved

616Tvariable

619Tmostly conserved

628Avariable

634Tmostly conserved

AACCTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACATCTCTTAGTTTATTAATTCGAACTGAATTAGGTAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes12

BINs4

Most divergent pair2.3%

AfricaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthocharis euphenoidessame genus4.1%Anthocharis grunerisame genus4.1%Anthocharis cardaminessame genus4.4%Celastrina sugitaniisame order5.1%Anthocharis damonesame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type458 records

Wild obs. + sensor253

Museum / vouchered205

Range

Area of Occupancy AOO984 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 158≤1 km 33≤10 km 20>10 km 15

226 georeferenced · 27 without coordinates

Open the mapobservation + sensor253

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 29≤10 km 58>10 km 30

117 georeferenced · 88 without coordinates

Open the institutions mapphysical evidence205

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	75
Cambridge, US	21
Helsinki, FI	17
Zürich, CH	15
Tartu, EE	10
Brussels, BE	9
Natural History Museum Rotterdamlocation not on record	9
RBINS-Scientific Heritagelocation not on record	8
New Haven, US	5
Cleveland Museum of Natural History, OH (CLEV)location not on record	4
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	3
Denver, US	2
Adam Mickiewicz University in Poznańlocation not on record	2
Philadelphia, US	1
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	1
Auckland, NZ	1

16 institutions · 183 of 205 vouchered records shown · 22 without an institution code

09Environmental DNA19 detections

Where the DNA of Anthocharis belia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 13.4–18.3

Seasonal swing summer↔winter16.7 °C

Max temp (day)20.8 °C 18.6–24.0

Min temp (night)9.40 °C 6.10–13.7

Precipitation55.5 mm/mo 26.8–70.5

Air humidity56.3 % 51.4–60.4

Moisture balance-71.1 mm/mo -116–-39.5

Vapour deficit838 Pa 685–994

Wind speed2.90 m/s 2.10–4.50

Cloud cover26.3 % 23.1–29.9

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)