Anthocharis euphenoides

Staudinger, 1869 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Anthocharis

At a glance

Occurrence records20 738

Data sources10

Biological traits0

DNA specimens36

eDNA detections38

Sources10 archives

Databases and archives Anthocharis euphenoides's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility20 738 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF20 738 records

Environmental DNA1 datasets · 3 countries38 detections

DNA & barcodingBOLD36 specimens

Genome at a glanceGoaT · NCBI≈379 Mbp

01Narrative

Anthocharis euphenoides, the Provence orange tip, is a species of butterfly in the family Pieridae. It is found in the Iberian Peninsula (missing in the southwest and northeast), in the south of France (from the eastern Pyrenees to the Alpes-Maritimes) and in Italy in the Abruzzo. There are a few records from Switzerland (Southern Ticino). Its caterpillars use Biscutella as their food source.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthocharis euphenoides has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes1

eDNA detections38

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

82Cmostly conserved

88Amostly conserved

247Cmostly conserved

271Cmostly conserved

412Cmostly conserved

562Cmostly conserved

565Gmostly conserved

AACCTTATATTTTATTTTTGGAATTTGATCAGGAATAGTGGGTACATCCCTTAGTTTATTAATTCGAACTGAATTAGGTAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.28%

Haplotypes13

BIN1

Most divergent pair0.91%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthocharis beliasame genus4.1%Anthocharis grunerisame genus5.3%Anthocharis cardaminessame genus5.3%Anthocharis damonesame genus6.2%Anthocharis juliasame genus7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anthocharis euphenoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈378 757 513 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anthocharis euphenoides0.38 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.8% BUSCO

08Occurrence & distribution

Record type20 738 records

Wild obs. + sensor19 261

Museum / vouchered1 001

Cultivated / captive448

Other28

Origin

Native525

Range

Area of Occupancy AOO25 180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 4 019≤1 km 2 810≤10 km 5 148>10 km 218

12 195 georeferenced · 7 066 without coordinates

Open the mapobservation + sensor19 261

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 11≤1 km 225≤10 km 115>10 km 47

398 georeferenced · 603 without coordinates

Open the institutions mapphysical evidence1 001

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 448 records without

Open the mapnot free-living448

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UMUlocation not on record	513
Natural History Museum Rotterdamlocation not on record	208
Zürich, CH	58
Helsinki, FI	33
Cambridge, US	24
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	20
Nijmegen, NL	20
NMOKlocation not on record	16
Tartu, EE	8
Brussels, BE	8
RBINS-Scientific Heritagelocation not on record	7
MZLUlocation not on record	6
Salzburg, AT	2
Banyoles, ES	2
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	2
Natural History Museum of Utahlocation not on record	2
Museu Nacional de História Natural e da Ciêncialocation not on record	2
Adam Mickiewicz University in Poznańlocation not on record	2
UGRlocation not on record	1
UVEG-ENVlocation not on record	1
Uniwersytet Łódzkilocation not on record	1

21 institutions · 936 of 1 001 vouchered records shown · 65 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA38 detections

Where the DNA of Anthocharis euphenoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.8 °C 11.4–17.0

Seasonal swing summer↔winter17.9 °C

Max temp (day)18.2 °C 15.6–21.5

Min temp (night)8.70 °C 5.50–10.5

Precipitation66.5 mm/mo 35.0–95.9

Air humidity56.8 % 53.0–59.8

Moisture balance-58.9 mm/mo -112–-24.2

Vapour deficit718 Pa 597–905

Wind speed3.30 m/s 2.20–4.10

Cloud cover40.3 % 35.6–44.4

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthocharis euphenoides

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type20 738 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 21 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type20 738 records