Anthocharis thoosa

(Scudder, 1878) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Anthocharis

At a glance

Occurrence records450

Data sources7

Biological traits0

DNA specimens32

eDNA detections35

Sources7 archives

Databases and archives Anthocharis thoosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility450 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF450 records

Environmental DNA1 datasets · 1 countries35 detections

DNA & barcodingBOLD32 specimens

01Narrative

Anthocharis thoosa, the southwestern orangetip, is a butterfly which has a range mainly from the American Rocky Mountains down into Mexico. It is a member of the Anthocharis sara complex.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthocharis thoosa has left across the world's sequence archives.

At a glance

DNA specimens32

BINs1

Marker genes1

eDNA detections35

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

118Cvariable

205Tmostly conserved

214Avariable

235Cmostly conserved

238Amostly conserved

268Gmostly conserved

271Cvariable

352Amostly conserved

355Tmostly conserved

364Tvariable

433Tvariable

460Tmostly conserved

466Amostly conserved

484Tmostly conserved

505Cmostly conserved

508Cmostly conserved

548Cmostly conserved

589Tmostly conserved

616Tvariable

628Amostly conserved

AACTTTATACTTTATTTTTGGAATTTGATCTGGAATAGTAGGTACATCTCTTAGTTTATTAATTCGAACTGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes20

BIN1

Most divergent pair2.3%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthocharis juliasame genus2.3%Anthocharis sarasame genus2.6%Euchloe lottasame family7.3%Anthocharis grunerisame genus7.3%Anthocharis cardaminessame genus7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type450 records

Wild obs. + sensor436

Museum / vouchered14

Range

Area of Occupancy AOO980 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 218≤1 km 106≤10 km 25>10 km 15

364 georeferenced · 72 without coordinates

Open the mapobservation + sensor436

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 14

14 georeferenced

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Natural History Museum of Utahlocation not on record	14

1 institutions · 14 of 14 vouchered records shown

09Environmental DNA35 detections

Where the DNA of Anthocharis thoosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 16.8–16.8

Seasonal swing summer↔winter21.9 °C

Max temp (day)24.0 °C

Min temp (night)8.50 °C

Precipitation14.9 mm/mo

Air humidity37.3 %

Moisture balance-127 mm/mo

Vapour deficit1,203 Pa

Wind speed2.70 m/s

Cloud cover32.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)